Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 897

2 members and 895 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,903
Threads: 249,097
Posts: 2,572,069
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 9 of 9

Hybrid View

  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by rufretic View Post
    Maybe I misunderstood op but I thought the male parent is grey matter which I believe is champagne super cinny?
    Ah, then the error must be on my end. I thought GreyMatter was a SuperPewter Pied.

    If GM does have Champ then my bet is the animals in question are Champagne Calico Pewter. The Champ Pastel looks very similar upon hatching and the synergy of Calico wiping out pattern when combined with Pastel is also pretty common so stacking those three together I can see leading to a whitish snake
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    fatSNAKEs (08-16-2019)

  3. #2
    BPnet Veteran fatSNAKEs's Avatar
    Join Date
    01-14-2009
    Location
    Kansas City
    Posts
    292
    Thanks
    296
    Thanked 321 Times in 132 Posts

    Re: Help Requested - ID Morph Super Form?

    hey guys, sorry for the delay was distracted by work. Appreciate your insights ... I'm in agreement with your thinking. Likely will go with Champagne Calico Pewter and call it good. This Gray Matter project feels like it will yield more surprises down the line. Not many out there yet, which I find interesting. thanks!
    David
    ______________________
    view my website:
    http://www.tornadoalleyreptiles.com/

  4. The Following User Says Thank You to fatSNAKEs For This Useful Post:

    rufretic (08-16-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1