Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,348

1 members and 1,347 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,928
Threads: 249,128
Posts: 2,572,274
Top Poster: JLC (31,651)
Welcome to our newest member, arushing027
Results 1 to 9 of 9

Threaded View

  1. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help Requested - ID Morph Super Form?

    Quote Originally Posted by rufretic View Post
    So my guess is that your white snakes are calico champagne cinnamon.
    But I do not see Champagne as being listed in either of the parents...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    fatSNAKEs (08-16-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1