Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,515

0 members and 1,515 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 3 of 3
  1. #1
    Registered User Kira8p's Avatar
    Join Date
    07-17-2019
    Location
    Austin TX
    Posts
    11
    Thanks
    3
    Thanked 6 Times in 4 Posts
    Images: 1

    Question Questions about RHP and Grow lights in bioactive enclosure

    Hey all, so I am converting a bookcase into bioactive enclosures for my BP's and have decided to go with RHPs and LED grow lights for each enclosure. I plan to mount each of these to the roof of each enclosure and my question is do I need to be concerned with my BPs burning themselves on either of these devices? If so what can I do to prevent it?

    Any constructive feedback is welcomed.
    Constant Learner

    Ball Pythons 2.7:

    Nagini 0.1 Normal
    Bananas 0.1 Albino Normal
    Lucy 0.1 BEL Super Mojave
    Slice 0.1 Pied Normal
    Mimosa 0.1 Pastel Cinnamon Champagne
    Eos 0.1 Super Enchi Champange
    Sabrina 0.1 Black Pastel Ghost 66% Het Pied
    Leopold 1.0 Leopard Phantom
    Drogo 1.0 Super Cinnamon Banana


    Other Pets:
    Reine 0.1 French Bulldog
    Hagrid 1.0 English Bulldog
    Mocha 0.1 Long haired Doxie
    Reddish 0.1 Guinea Pig

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Neither RHPs nor LEDs will get hot enough to burn your animal
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    Bodie (08-08-2019)

  4. #3
    BPnet Veteran gunkle's Avatar
    Join Date
    01-05-2008
    Location
    Andover, Ct
    Posts
    431
    Thanks
    498
    Thanked 348 Times in 209 Posts
    Images: 2

    Re: Questions about RHP and Grow lights in bioactive enclosure

    Keep in mind the RHP from a lower enclosure will heat the floor of the enclosure above it. Especially if there is no air gap between enclosures. Remember heat rises. I had to create a 2 inch air gap between my two custom 3/4 inch thick enclosures because th RHP of the bottom one was heating through the top of the lower one and through the floor of the top one. Causing too much heat on the floor of the top one. That's about 1.5 inches of hardwood plywood it was heating through. With the floor being heated from below I couldn't run the RHP in the top one to maintain ambient temps without over heating that side. I hope this makes sense.
    1.0 Bearded Dragon
    0.1 Super Pastel Lesser Ball Python
    1.0 Pastel Bamboo Ball Python
    0.0.1 Halmahera Blue Tongue Skink
    0.0.2 Crested Gecko
    1.2.Guinea Pigs
    1.0 Leopard Gecko
    0.1 Toad
    0.1 Iguana
    0.1 Dog
    0.2 Cats

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1