Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 848

0 members and 848 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 5 of 5
  1. #1
    Registered User
    Join Date
    04-14-2019
    Posts
    10
    Thanks
    3
    Thanked 8 Times in 4 Posts

    Please help, new bp, BEL v White wedding COLOR

    Hello,

    I have a few bps, my favorite a white wedding spied girl (Black eyes). I’d really like to get another white snake but this time a BEL. I’ve researched around the web, YouTube, and some old posts but no one has ever has experienced a comparison of a super lesser BEL (which I think is the most stark white of the BELs - please correct me if I’m wrong) and a white wedding spied.


    I was was wondering if any aficionados or breeders have seen comparisons of the two and if the BEL can never compare to the stark white of a WW when the bo reaches adulthood.

    I have the option of purchasing another WW (from the same clutch as my girl). If the BEL can’t compare then I’ll bring him home.

    And no I do not plan to breed, I just love loving bps.
    Thank you for the help!

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Please help, new bp, BEL v White wedding COLOR

    Quote Originally Posted by CCBaer View Post
    I was was wondering if any aficionados or breeders have seen comparisons of the two and if the BEL can never compare to the stark white of a WW when the bo reaches adulthood.
    I do not have any Pied animals but I have a SuperFire, a Hypo Lesser/Mojave and I had an Ivory Butter OD Pastel so I know a bit about white snakes. I have also visited a number of friend's collections and seen adults of a bunch of things.

    The most stark white snakes I have seen are the all-white BlkELs. The white I have seen on adult high-percentage Pied animals is the same degree of stark white so I would believe that an all-white Pied combo would be equal in that regard.

    Every BluEL adult I have seen has had some faint level of pigmentation to them, they are more cream-coloured than white. I have also yet to see an adult BluEL of any type that does not have some kind of faintly visible dorsal stripe
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (08-01-2019),CCBaer (08-01-2019),PartySnake13 (08-15-2019)

  4. #3
    Registered User
    Join Date
    04-14-2019
    Posts
    10
    Thanks
    3
    Thanked 8 Times in 4 Posts

    Re: Please help, new bp, BEL v White wedding COLOR

    Thank you so much for the input, greatly appreciated and what I was looking for.

    btw, lovely collection of white snakes you got there!

  5. #4
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    i agree w/ Dr. Ash. an all white BlackEL like a patternless Super Fire will be brighter and whiter than white BlueEL's. also i have an adult Lied (Lesser Pied) who has stayed all white since i got her as a hatchling. the whites in Pieds stay white and vibrant but sometimes they do develop a black freckle here and there butt i haven't seen that on all white Pieds yet.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  6. #5
    Registered User luizillo's Avatar
    Join Date
    06-13-2012
    Location
    Mexico, Nuevo Leon, Monterrey
    Posts
    17
    Thanks
    25
    Thanked 1 Time in 1 Post

    Re: Please help, new bp, BEL v White wedding COLOR

    beLI am agree with answers. If you are lloking for a full white nothing is more white than the one in a piebald. I would say go for a BEL anyways there are gorgeous. I have a bamboo.mojave BEL and a pied and its just a different taste having both. Those blue eyes have no comparison.
    Now
    0.1.0 BP.Piebald
    0.1.0 BP.Pinstripe Axanthic VPI
    1.0.0 BP.Killer Bee Axanthic VPI
    0.1.0 BP. Pastel Clown
    0.1.0 BP. Leopard
    0.1.0 BP. Yellow Belly
    0.1.0 BP. Highway
    0.1.0 BP. BEL (Bamboo.Mojave)
    0.1.0 BP. Lavender albino black pastel
    Before
    0.1.0 BP.Lemon Pastel
    1.0.0 BP.Spider
    0.1.0 BP.Lesser Platinum
    1.0.0 BP.Mojave
    0.1.0 BP.Albino

    Regius de Mexico! https://www.facebook.com/groups/384981598187671/
    Chondros de Mexico! https://www.facebook.com/groups/319764831411463/
    Carpet pythons de Mexico! https://www.facebook.com/groups/194663807321316/

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1