Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,039

1 members and 1,038 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,142
Posts: 2,572,344
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 5 of 5

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Please help, new bp, BEL v White wedding COLOR

    Quote Originally Posted by CCBaer View Post
    I was was wondering if any aficionados or breeders have seen comparisons of the two and if the BEL can never compare to the stark white of a WW when the bo reaches adulthood.
    I do not have any Pied animals but I have a SuperFire, a Hypo Lesser/Mojave and I had an Ivory Butter OD Pastel so I know a bit about white snakes. I have also visited a number of friend's collections and seen adults of a bunch of things.

    The most stark white snakes I have seen are the all-white BlkELs. The white I have seen on adult high-percentage Pied animals is the same degree of stark white so I would believe that an all-white Pied combo would be equal in that regard.

    Every BluEL adult I have seen has had some faint level of pigmentation to them, they are more cream-coloured than white. I have also yet to see an adult BluEL of any type that does not have some kind of faintly visible dorsal stripe
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (08-01-2019),CCBaer (08-01-2019),PartySnake13 (08-15-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1