Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,753

0 members and 1,753 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,104
Threads: 249,253
Posts: 2,572,982
Top Poster: JLC (31,651)
Welcome to our newest member, GarlandFbj
Page 1 of 2 12 LastLast
Results 1 to 10 of 12
  1. #1
    Registered User
    Join Date
    04-08-2019
    Posts
    27
    Thanks
    2
    Thanked 5 Times in 3 Posts

    Blacklight on a BEL to see what its hiding?

    Hi everyone.
    I'm still indecisive about what would make a good first pair... There's just so many beautiful colors out there. Every time I think I've decided I give it a week or so, and I get entranced by a new color! lol
    I'm currently liking firefly, and I really love pastel leopards too. And BELs are just so darn adorable. So I was looking at a pairing of a firefly + firefly leopard.. (I just know if I get a female firefly I'm gonna name her Serenity. If you don't get that reference, you missed out on the best show that was canceled too soon, lol)
    Only problem is, about 25% of the babies would be black eyed leucistics, and most of them would contain other genes. I've heard that putting a blacklight over them can bring out hidden patterns--would this show me if leopard got passed down? Or does that not always work?
    Of course, it might be impossible to tell if the pastel/super pastel came through...
    Even if it turns out that there is no way to tell, it would still be fun to play around with proving out the 'gamble babies' in a few years.
    Here's the calculator, you can see lots of BELs on there. https://www.morphmarket.com/c/reptiles/pythons/ball-pythons/genetic-calculator/?s1=Fire%2CLeopard%2CPastel&s2=Firefly



  2. #2
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    I would do firefly yb x pastel leopard yb. It will eliminate the chance of getting super fire bels but will give you a chance at ivory and the really cool thing with that pairing if you hit leopard with the ivory, you don't need a blacklight to know, you'll see it, ivory leopards are awesome!

  3. #3
    Registered User
    Join Date
    04-08-2019
    Posts
    27
    Thanks
    2
    Thanked 5 Times in 3 Posts
    Are ivorys still white though? Every picture I've seen is more creamy/dirty white. Whereas the super fire seems like it turns out cleaner, or is clean white with little yellow spots.

  4. #4
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    My ivory was as clean and bright white as any other bel I've seen but it does vary. For the cleanest white snake, super fire is far from your best option as well.

  5. #5
    Registered User
    Join Date
    04-08-2019
    Posts
    27
    Thanks
    2
    Thanked 5 Times in 3 Posts
    What's the cleanest with black eyes then?

  6. #6
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Blacklight on a BEL to see what its hiding?

    Quote Originally Posted by Aziara View Post
    What's the cleanest with black eyes then?
    White wedding but it's not a bel. If you want to make bels then super fire and ivory are the two black eyed options that come to mind. I've seen nice white examples of both and I've also seen dirty examples of both so which ever you choose, you just need to hope the ones you produce come out nice.

    The only reason I brought up using yb to make ivorys is because you're original pairing goals were white snakes and leopard but you were worried about IDing the leopard in the white snakes and using ivory instead eliminates that problem and will also give you the best combo you can get out of the morphs discussed so far, leopard ivorys are nice.

    But if you're decided on the pairing you came up with, then just go with that but don't expect to be able to ID your bel combos.

  7. #7
    Registered User
    Join Date
    04-08-2019
    Posts
    27
    Thanks
    2
    Thanked 5 Times in 3 Posts
    Ok, thanks for your input. I might be trying for too many things with my first pairing. I really like the idea of having a lot of variance in clutches, but maybe I should hold off on BEL unless I can be sure what's in it. Is it difficult to sell "possible (trait)" snakes?
    Firefly + pastel leopard could still give some gorgeous clutches, without throwing me a bunch of mystery snakes.

  8. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Blacklight on a BEL to see what its hiding?

    Quote Originally Posted by rufretic View Post
    For the cleanest white snake, super fire is far from your best option as well.
    Curious how you came to that conclusion?

    I have a SuperFire that is stark white, not a single yellow scale on her. She is, hands down, the whitest snake I have seen out of any of the three "white complexes". When I put her with my Hypo Lesser/Mojave and my Ivory Butter OD Pastel they both look dingy by comparison.

    For the whitest snake out there, the all white BlkELs are probably the best bet. To get that from Fires might take adding other genes to them (which the OP would certainly accomplish with FireFly x FireFly Leopard) but there are others in the same complex that seem to throw solid whites at high frequency - Sauce, Lemonback, Lucifer, Mota, etc.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #9
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Blacklight on a BEL to see what its hiding?

    Quote Originally Posted by asplundii View Post
    Curious how you came to that conclusion?
    I've seen many super fires and almost every one has had something going on keeping it from considered pure white. I've also seen many ivorys that are also far from pure white. But like your super fire example, I had the same experience but with an ivory, pure white. So our examples are not the norm. The typical pure white snakes I see at almost every show are almost always blue-el, I have not paid enough attention to see if they are super lessers or what combo but from the 100s of bels I've seen, black-el are typically not the cleanest pure white. Are there exceptions to this, yes.

  10. #10
    Registered User
    Join Date
    04-08-2019
    Posts
    27
    Thanks
    2
    Thanked 5 Times in 3 Posts

    Re: Blacklight on a BEL to see what its hiding?

    Quote Originally Posted by asplundii View Post
    Curious how you came to that conclusion?

    I have a SuperFire that is stark white, not a single yellow scale on her. She is, hands down, the whitest snake I have seen out of any of the three "white complexes". When I put her with my Hypo Lesser/Mojave and my Ivory Butter OD Pastel they both look dingy by comparison.

    For the whitest snake out there, the all white BlkELs are probably the best bet. To get that from Fires might take adding other genes to them (which the OP would certainly accomplish with FireFly x FireFly Leopard) but there are others in the same complex that seem to throw solid whites at high frequency - Sauce, Lemonback, Lucifer, Mota, etc.
    I suppose the reason I came to the idea that SuperFire would be mostly white, is I went on morphmarket.com and it looked like 50-75% of the SuperFires for sale were pure white, and the others had little yellow spots on a bright white background (and one of those was also banana, so I imagine that would ensure yellow spots). Despite not being fond of pied, I find those little yellow spots really cute, like a little spotted kitty.
    Is this not the normal ratio of spots to no spots??

    As for the other morphs you mentioned, there's a single picture on worldofballpythons.com of a Fire Lucifer, and it's pure white, but I'm not sure if that is the norm or just the only submitted pic. Cool name though

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1