Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 486

0 members and 486 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,070
Threads: 249,219
Posts: 2,572,800
Top Poster: JLC (31,651)
Welcome to our newest member, mh789
Results 1 to 8 of 8
  1. #1
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts

    Rhino rat snake info

    I had been researching this snake for months. Yesterday at the expo, I was lucky to find an available adult rhino rat for sale and as soon as I held him, I was in love. Unfortunately, bad news is that I was not ready yet and have not gone through details on how set up its enclosure. And for a $700 snake, I did not want to risk it and screw it up, and...Good news is I finally found the gray banded kingsnake I had been looking for almost a year! Pictured will be available after he settles down and eats for me. I don't usually take pics on first days.

    Anyways, I am rereading my research material and there are very few and far in between. Anyone who had kept them can chime in? I had found care sheets suggesting a basking spot from 79-89 F, another from 85-90F and then 75-85F. Being a snake found in higher elevation, is this a species that prefers cooler temps, similar to the Mandarin rat?

    This will be my first aboreal snake. I am reading a lot of materials on chrono set ups and since both snakes need high humidity and branches to climb. A heat mat would not be sufficient, right? CHE heating with dimmer? Coco fiber for substrate in a glass tank? Or should I use tubs? Big bowl of water for soaking? How big and tall is a good size for an adult? What do you use for hides that are off the ground?

  2. #2
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts
    I don't know all that many keepers with experience keeping rhino rats, but fellow forum friend Zibcubus keeps one. Hopefully he'll chime in when he sees this.

    @Zincubus, you there???
    @Bogertophis may have some knowledge here too
    Last edited by Craiga 01453; 07-22-2019 at 09:37 AM.

  3. The Following User Says Thank You to Craiga 01453 For This Useful Post:

    Zincubus (07-22-2019)

  4. #3
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,009
    Thanks
    2,526
    Thanked 4,966 Times in 3,028 Posts

    Rhino rat snake info

    I’d certainly go the glass tank route or wooden viv with glass doors as these snakes are fantastic display snakes !
    Not just because of their spectacular colouration but mine was also a marvellous climber and never seemed to sleep . Very inquisitive and great to handle .
    I had a heat mat under the Eco Terra tank and a small 7W heat mat stuck on the outside of the tank’s back wall about half way up so some of the branches were warm ..

    The temps you mentioned look fine - it’s hard to state a perfect temp as mine didn’t have any hides as it just used to crash out anywhere and everywhere at the base of the tank or somwhere in the branches . I had a decent sized , natural looking water bowl so it blended into the landscape -placed under the branches . The Rhino rat snake spent a good amount of time actually submerged !!
    If he was under water at feeding time I fed as normal and he used to snatch the mouse /rat off the tongs and devour it UNDERWATER !!

    I used orchid bark/Repti bark as it looks great and natural, holds humidity well and made the Green Rhino look even more stunning !

    Sooooo.. I’ve drastically reduced the numbers in my collection down from 24 to just 7 !!

    Sadly the Rhino was one of the first to go as there was so much interest in it ..

    Mine was a young adult I’d say ... just over 3’ long


    Sent from my iPhone using Tapatalk Pro
    Last edited by Zincubus; 07-22-2019 at 11:02 AM.




  5. The Following 3 Users Say Thank You to Zincubus For This Useful Post:

    Bogertophis (07-22-2019),Cheesenugget (07-22-2019),Craiga 01453 (07-22-2019)

  6. #4
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,956
    Thanks
    29,644
    Thanked 20,748 Times in 12,417 Posts
    Sorry to say I have no information about these snakes, but I do have a suggestion about furnishing hides for arboreal (or even semi-arboreal) species: I use
    baskets for many of my snakes & they love them, both as platforms to rest and sleep in or on. Baskets come in all shapes & sizes, & they're easy to attach to
    branches. They're cheap & readily available in thrift stores; I do recommend washing them off with soap & water & spraying down with whatever disinfectant*
    you use to clean your cages & let them dry. (*like F10 or chlorhexidine, NOT bleach as the fumes would never leave) For some reason my snakes seem to love
    the secure feeling of curling up in baskets, & I don't normally put anything in them, but you could also add moss or something if you wanted. They don't typically
    defecate in/on them, but you can wash them off anyway...most baskets are more sturdy than you might think.

    Really happy to see some less common species get some attention.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

    The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi

  7. The Following 3 Users Say Thank You to Bogertophis For This Useful Post:

    Cheesenugget (07-22-2019),Craiga 01453 (07-22-2019),Zincubus (07-22-2019)

  8. #5
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts

    Re: Rhino rat snake info

    Quote Originally Posted by Bogertophis View Post
    Sorry to say I have no information about these snakes, but I do have a suggestion about furnishing hides for arboreal (or even semi-arboreal) species: I use
    baskets for many of my snakes & they love them, both as platforms to rest and sleep in or on. Baskets come in all shapes & sizes, & they're easy to attach to
    branches. They're cheap & readily available in thrift stores; I do recommend washing them off with soap & water & spraying down with whatever disinfectant*
    you use to clean your cages & let them dry. (*like F10 or chlorhexidine, NOT bleach as the fumes would never leave) For some reason my snakes seem to love
    the secure feeling of curling up in baskets, & I don't normally put anything in them, but you could also add moss or something if you wanted. They don't typically
    defecate in/on them, but you can wash them off anyway...most baskets are more sturdy than you might think.

    Really happy to see some less common species get some attention.
    You let me down, hahahahhaha. Just playing, I just figured I'd toss your name out there since you're one of our most knowledgeable colubrid keepers.

    But yeah, cool seeing some other species pop up.

  9. The Following 2 Users Say Thank You to Craiga 01453 For This Useful Post:

    Bogertophis (07-22-2019),Zincubus (07-22-2019)

  10. #6
    BPnet Veteran Starscream's Avatar
    Join Date
    06-29-2017
    Location
    Missouri
    Posts
    987
    Thanks
    1,221
    Thanked 1,263 Times in 629 Posts
    Images: 1

    Re: Rhino rat snake info

    I don't have any personal experience (yet), but I did find some scientific articles about these during research of my own.

    https://www.researchgate.net/publica...oma_boulengeri
    This one discusses captive breeding and the husbandry used to enable the breeding of this species, as well as what was used to get the resulting hatchlings to thrive.

    The following screenshot is from Frans Baines' UV-tool and shows the ranges accepted for heating/lighting for different species. I only screenshooted the page with the Rhino rat snake, but if you want the entire document I'm sure I could figure out how to send it to you. Biome 1 references tropical and subtropical moist broadleaf forests. Ferguson Zone references UV, if you decided to provide that. The microhabitat letters are for E - foliage or shrubs, G - semi-arboreal, and H - arboreal.
    0.1 Red Axanthic P. regius | Mazikeen
    0.1
    E. climacophora | Lan Fan


  11. The Following 4 Users Say Thank You to Starscream For This Useful Post:

    Bogertophis (07-22-2019),Cheesenugget (07-22-2019),Craiga 01453 (07-22-2019),Zincubus (07-22-2019)

  12. #7
    Registered User
    Join Date
    10-02-2013
    Posts
    31
    Thanks
    10
    Thanked 66 Times in 20 Posts

    Re: Rhino rat snake info

    I keep a female Gonyosoma boulengeri since 2013, I got her as a youngster and she has grown to about 120 cm (ca 4 ft) now. I keep her pretty much as Zincubus describes it. Currently she is still in a smallish exoterra enclosure (90 x 45 x 90 cm / 36 x 18 x 36 in), ReptiBark as substrate, some branches, some real plants, a water bowl. As Zincubus already said, she spends a lot of time in the water.

    I use a T5 florescent for basic light and a 75 W Metal Halide Light to provide a hot spot and UVB. I don’t use any other heating. Under the MHL the temperature might get as high as 32° C (90° F) while the opposite side of the enclosure is room temperature (usually around 23° C / 73,5° F), providing a horizontal and vertical temperature gradient for the snake. I found that my snake will bask directly under the MHL for some time and then move to cooler places. On general terms, they don’t need high temperatures, but will use a local hot spot. You should bromate the snake for some weeks, not a really cold brumation, but with reduced light, reduced temperatures (especially during the night) and no food.

    Tubs is in my opinion a bad idea, especially for an arboreal snake. Everything coming from above is usually a bad thing (like bird of prey), so opening the lid to do your maintenance might stress an already nervous snake and provoke defensive actions like fleeing or even biting. A front opening enclosure allows you to work from below the snake, so it will usually stay more calm and relaxed.

    I feed my female with medium or large mice and sometimes with day-old chicken.
    1,0 Lampropeltis triangulum campbelli, 1,2 Gonyosoma oxycephalum, 1,2 Philodryas baroni, 1,2 Spilotes pullatus, 2,1 Spilotes sulphureus, 0,1 Gonyosoma boulengeri, 1,1 Zamenis longissimus, 0,1 Malpolon sp., 1,1 Malpolon monspessulanus

  13. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If you can get a hold of him I would recommend talking to Rob Stone, he keeps and consistently breeds this species and is a wealth of information. He also did an episode covering them on the Morelia Python Radio podcast so you might want to give that a listen:

    http://www.blogtalkradio.com/morelia...with-rob-stone
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (07-26-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1