Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,921

0 members and 1,921 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,086
Threads: 249,227
Posts: 2,572,841
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
Results 1 to 5 of 5
  1. #1
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Questions about paradoxes.

    My question I have is, is there any draw back with reptiles that have the paradox? Neurological, kinks, eating issues, or shortened lifespan? Has anyone experienced a link to paradox and any of these issues or others not mentioned?

  2. #2
    BPnet Veteran pretends2bnormal's Avatar
    Join Date
    09-07-2017
    Posts
    861
    Thanks
    713
    Thanked 1,179 Times in 575 Posts
    Images: 7

    Re: Questions about paradoxes.

    Nothing I've ever heard of along those lines, though I'm not exactly an expert. I read and watch a lot, though and haven't seen it come up at all.

    Eating and lifespan is likely just as random as for any other animal.

    Only concern I've heard mentioned anywhere is that in highly paradoxed animals (i.e. 50/50 color/pattern overall), is that there can be concern about which set of genes will pass on genetically when it is bred.
    (I.e. a banana pied with normal pied paradox scattered throughout, is it able to pass on banana and pied or only pied?)

    Sent from my SM-G950U using Tapatalk
    Last edited by pretends2bnormal; 07-09-2019 at 01:26 PM.

  3. The Following 2 Users Say Thank You to pretends2bnormal For This Useful Post:

    Bogertophis (07-09-2019),Lord Sorril (07-09-2019)

  4. #3
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1
    No there are none
    Deborah Stewart


  5. #4
    BPnet Veteran the_rotten1's Avatar
    Join Date
    07-22-2016
    Location
    Bakersfield, CA
    Posts
    613
    Thanks
    3,352
    Thanked 645 Times in 319 Posts
    Images: 11
    Paradoxing in Ball Pythons doesn't usually pass on to offspring in a predictable way, so they wouldn't have any defects linked to genetics like the spider wobble, desert fertility issues, caramel kinks, etc. I don't have a lot of experience with paradoxes, but I'd imagine the health of any snake with a paradox would be dependent on it's husbandry and the health of it's parents, just like any other snake.
    ~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~

    Check me out on iHerp, Instagram, & visit my store!


  6. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Cross posting my answer in the other forum here just to provide the information:

    I have spoken with a number of people with paradox animals and none of them have reported issues.

    The one thing that can come in to play is when you breed them - depending on how the mosaicism/chimerism is distributed within the body the sex organs can be effected. This can be something simple, like an animal breeding out like a het rather than a visual or as a WT rather than a het, or it can also be something extreme, like having an animal that pops hemi-penes but has ovaries instead of testes. The prior has been directly documented in paradox carpet pythons by two separate breeders (Nick Mutton and Wayne Larks)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1