Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 838

0 members and 838 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,900
Threads: 249,096
Posts: 2,572,067
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 10 of 17

Threaded View

  1. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Help identifying bel complex hatchlings

    Quote Originally Posted by PitOnTheProwl View Post
    Depends on what made the BEL...
    I think you are misunderstanding her. She is observing that every hatchling must be one of the het BluEL morphs because the parent is a BluEL. In this case, since we are assuming the BluEL is Mojave/Lesser, every baby will have to be, at a minimum, either a Mojave and/or Lesser
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    PartySnake13 (08-09-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1