Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,707

1 members and 1,706 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,229
Posts: 2,572,847
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Page 1 of 2 12 LastLast
Results 1 to 10 of 13

Thread: SD Retic

  1. #1
    BPnet Veteran
    Join Date
    03-07-2019
    Posts
    810
    Thanks
    206
    Thanked 474 Times in 249 Posts

    SD Retic

    So I have been thinking and debating. Since I was told I can't keep a SD Retic in a tub for its whole life, Can I keep it in a V-180 until its about 5-6 Foot, and then upgrade to a 6x2.? The V180 is 40"x31"x10"

  2. #2
    BPnet Veteran
    Join Date
    03-07-2019
    Posts
    810
    Thanks
    206
    Thanked 474 Times in 249 Posts

    Re: SD Retic

    I've just wanted a Retic of my own ever since I took care of one at my school many many years ago. I have experience with them. The one I took care of was a 16 foot normal female. She was very docile, and only bit me once. I accidentally stepped on her tail. So Ife I can keep it in a tub for say the first 2 years, I wouldn't mind getting a 4x2 later on

  3. #3
    BPnet Royalty Gio's Avatar
    Join Date
    05-28-2012
    Location
    Minneapolis
    Posts
    4,804
    Thanks
    7,005
    Thanked 6,797 Times in 3,059 Posts
    If you are going the SD route, I'd skip any kind of tub. Unless you are a breeder or space is really an issue.

    Retics are extremely arboreal and enjoy climbing and perching. Obviously if you are dabbling in mainland animals, the arboreal part is probably not something most people can afford to do.

    I find my SD X Dwarf X Mainland (only 18%) extremely active. I have two friends here who also had SD's, one pure and one a mix like mine. Both of those snakes were difficult keeps and both were placed. Their keepers felt cage size was important, and actually provided good sized enclosures. The pure SD was in a giant cage.

    The pure SD was unfortunately a nightmare unfortunately and not all that small for a pure Kalatoa.

    If you are just focusing on your own SD, why not give it some living space? They are excellent display animals and I think you'd enjoy seeing the smaller package display the wild behaviors they often show in captivity.

    This cage is 6 feet wide, 2 feet tall and 30 inches deep. The snake is roughly 8-9 feet long.


    With a pure SD, you could likely go 4 feet wide, 2 feet tall and 30 inches deep. I nice cage size for an active animal.


    It doesn't get much better than seeing this action.


    Honestly, this animal is about 50-50 arboreal and terrestrial. He is a real treat to watch.


    Just my two bits, but I'd do yourself a favor, and really the snake too, and focus on caging as part of the experience.

    UNLESS, you are a breeder keeping several snakes or don't have the space.

    However if you don't have the space maybe the species isn't the right choice?

    Best of luck, I hope you get what you want.

  4. The Following 5 Users Say Thank You to Gio For This Useful Post:

    Bogertophis (06-14-2019),fadingdaylight (06-15-2019),jmcrook (06-14-2019),Mirakuru (06-14-2019),Team Slytherin (06-15-2019)

  5. #4
    BPnet Veteran oodaT's Avatar
    Join Date
    08-30-2017
    Location
    Raleigh, NC
    Posts
    564
    Thanks
    36
    Thanked 632 Times in 295 Posts
    Images: 2

    Re: SD Retic

    At the given time of her size, I have my 75% kalatoa 12.5% jampea in a 4x2x2 with a shelf that spans across the back. She is 16 months old, bout 6 foot. Relatively new cage, so its bare at the moment. But you can see how much room she has. Shes never really used a hide so have none in there. Just going to be adding some vines, foliage and branches for her.

    Sent from my SM-G955U using Tapatalk

    0.1 75% Kalatoa 12.5% Jampea Super Dwarf Retic - Enyo
    0.1 62.5% Purple Phase Jampea - Eris
    1.0 Platron Sunfire Mainland - Hades
    0.1 Albino Suntiger - Xena
    0.1 Platinum Citron Sunfire Albino - Aphrodite

    "Animals are not property or things but rather living organisms, subjects of a life, who are worthy of our compassion, respect, friendship and support."

  6. #5
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: SD Retic

    Quote Originally Posted by Gio View Post
    If you are going the SD route, I'd skip any kind of tub. Unless you are a breeder or space is really an issue.

    Retics are extremely arboreal and enjoy climbing and perching. Obviously if you are dabbling in mainland animals, the arboreal part is probably not something most people can afford to do.

    I find my SD X Dwarf X Mainland (only 18%) extremely active. I have two friends here who also had SD's, one pure and one a mix like mine. Both of those snakes were difficult keeps and both were placed. Their keepers felt cage size was important, and actually provided good sized enclosures. The pure SD was in a giant cage.

    The pure SD was unfortunately a nightmare unfortunately and not all that small for a pure Kalatoa.

    If you are just focusing on your own SD, why not give it some living space? They are excellent display animals and I think you'd enjoy seeing the smaller package display the wild behaviors they often show in captivity.

    This cage is 6 feet wide, 2 feet tall and 30 inches deep. The snake is roughly 8-9 feet long.


    With a pure SD, you could likely go 4 feet wide, 2 feet tall and 30 inches deep. I nice cage size for an active animal.


    It doesn't get much better than seeing this action.


    Honestly, this animal is about 50-50 arboreal and terrestrial. He is a real treat to watch.


    Just my two bits, but I'd do yourself a favor, and really the snake too, and focus on caging as part of the experience.

    UNLESS, you are a breeder keeping several snakes or don't have the space.

    However if you don't have the space maybe the species isn't the right choice?

    Best of luck, I hope you get what you want.
    This is something I completely agree with. I feel it is a quality of life thing for an intelligent species that is active and enjoys climbing, swimming, and exploring from time to time.

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    OP,

    If you are really serious on a SD retic then my suggestion to you would be to get in contact with Garrett Hartle of Reach Out Reptiles. He specializes in SD and SD crosses and is a wealth of information
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #7
    BPnet Veteran SilentHill's Avatar
    Join Date
    02-06-2019
    Location
    Adams Co, PA
    Posts
    335
    Thanks
    104
    Thanked 454 Times in 185 Posts
    Images: 3

    Re: SD Retic

    Quote Originally Posted by asplundii View Post
    OP,

    If you are really serious on a SD retic then my suggestion to you would be to get in contact with Garrett Hartle of Reach Out Reptiles. He specializes in SD and SD crosses and is a wealth of information
    yes, please contact Garrett. SUPER nice guy and will tell you straight up how to keep a SD retic. then follow-up with a purchase from him. beautful healthy animals.
    Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Penny, Wednesday
    Crested Geckos: Eggs, Triscuit, Creature & Waffles
    Leopard Geckos: Rhubarb, Pepper and Clementine
    Cal Kings: Bones & Violet
    Corn snakes: A sh*tload
    Trans-Pesos: 1.1 No names
    BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter), Jameson
    BCI Boa: Specter (Fineline morph)
    SnuSnu the cat, Corbin the pit bull, Juniper the mini aussie & Lily the setter mix
    One little special needs bearded dragon P. Sherman
    Black African House Snakes: 1.1 No names
    Northern Pines: 1.1 No names
    Four skinks, one of which is named Gator & Basil the mini-lop rabbit


    'everything was beautiful and nothing hurt' - vonnegut.

    www.facebook.com/SilentHillReptiles

  9. The Following User Says Thank You to SilentHill For This Useful Post:

    asplundii (06-18-2019)

  10. #8
    BPnet Veteran Justin83's Avatar
    Join Date
    07-26-2016
    Location
    Uk
    Posts
    430
    Thanks
    279
    Thanked 354 Times in 189 Posts
    Images: 16
    SD are all different, you might get one that pushes is the main issue and smashes his face up.
    My 2yr old male dwarf X SD is in a 5*2*2 and 6+ft long, he weighs 1000g.
    1.0 75% SD retic .... 6ft Hector cb17 1.1kg
    0.1 coastal X ij carpet... Hielo cb15 8kg

    1.1 crested gecko Vinnie + Mable

  11. #9
    BPnet Veteran
    Join Date
    03-07-2019
    Posts
    810
    Thanks
    206
    Thanked 474 Times in 249 Posts
    Well I spoke to my GF about this, and when I mentioned theres a possibility of getting one that gets to 12-13Ft She said No Go. So for now the Retic is on hold. I'm hoping that after a few years with my Bloods and other species I plan on getting that she will warm up to the idea. If not. thats ok too.

  12. #10
    BPnet Veteran
    Join Date
    03-07-2019
    Posts
    810
    Thanks
    206
    Thanked 474 Times in 249 Posts
    When I previously spoke with her I had mentioned they get much larger, but she didn't understand how long. When I specified 13' she said no way. Its better to find out now, then to have a 12' retic with no where to live.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1