Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 678

0 members and 678 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,138
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 2 of 2
  1. #1
    BPnet Veteran SilentHill's Avatar
    Join Date
    02-06-2019
    Location
    Adams Co, PA
    Posts
    335
    Thanks
    104
    Thanked 454 Times in 185 Posts
    Images: 3

    baltimore md Repticon

    ...this weekend! anyone attending? we will be there both days.

    Sent from my SM-G950U using Tapatalk
    Gargoyle Geckos: Gorey, Gremmie, Ouija, Gojira, Bacon Bit, Penny, Wednesday
    Crested Geckos: Eggs, Triscuit, Creature & Waffles
    Leopard Geckos: Rhubarb, Pepper and Clementine
    Cal Kings: Bones & Violet
    Corn snakes: A sh*tload
    Trans-Pesos: 1.1 No names
    BPs: Charlie (super pastel), Bodhi (pied), Finn (GHI Mojave), Dublin (fire bumblebee), Falkor(mystic potion), Letty (pewter), Jameson
    BCI Boa: Specter (Fineline morph)
    SnuSnu the cat, Corbin the pit bull, Juniper the mini aussie & Lily the setter mix
    One little special needs bearded dragon P. Sherman
    Black African House Snakes: 1.1 No names
    Northern Pines: 1.1 No names
    Four skinks, one of which is named Gator & Basil the mini-lop rabbit


    'everything was beautiful and nothing hurt' - vonnegut.

    www.facebook.com/SilentHillReptiles

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I will be there Sunday, picking up a rack (or two)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    SilentHill (05-23-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1