Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,256

2 members and 1,254 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 9 of 9
  1. #1
    Registered User pretzelpretzel's Avatar
    Join Date
    12-09-2017
    Location
    NEPA
    Posts
    75
    Thanks
    55
    Thanked 21 Times in 16 Posts

    animal plastics advice

    okay sooo here’s the thing. Pretzel is getting quite large and no longer fits in his small cage (which is 24 inches long i think) He is over a year old and appears to be almost done growing but probably still has a bit more to go. He is way too large for the cage and can’t really stretch out, so i’ve had to take him out most days to let him stretch out and move on the floor.
    So I’ve been looking into getting an animal plastics cage. However I still live at my parents house and therefore pretzel is on my dresser. If i got a new cage they said the only place i can put it is downstairs in this cabinet we have( the new cage won’t fit on my dresser as it’s quite small) , so i can shut the cabinet doors when people come over who aren’t snake fans. the cabinet would only fit a t4 which is (36L by 24W by 15h). However I am nervous; will that size be good for a full grown ball python his whole life? The t10 (48L by 24W by 15H) seems better but it wouldn’t fit in the cabinet and i’d have no place to put it. Is it worth it to wait to move out and get the t10? I am planning on moving out in around a year or maybe less if things go well. I just feel so bad right now he seems very cramped in his cage and there’s very little room for him to move and stretch out. Thanks :-)


    Sent from my iPhone using Tapatalk

  2. #2
    BPnet Royalty EL-Ziggy's Avatar
    Join Date
    11-05-2014
    Location
    GA
    Posts
    4,224
    Thanks
    5,090
    Thanked 5,533 Times in 2,710 Posts

    Re: animal plastics advice

    The T4 might get a little tight for a large adult BP. I definitely like the T10 option better but I understand you don't want to buy (2) adult enclosures. Perhaps you could find a large tub to house him in until you can get the T10. Tubs are pretty inexpensive to set up.
    Last edited by EL-Ziggy; 05-06-2019 at 06:13 PM.
    3.0 Carpet Pythons, 1.1 Bullsnakes
    1.0 Olive Python 1.0 Scrub Python,
    1.0 BI, 0.1 BCO

  3. The Following User Says Thank You to EL-Ziggy For This Useful Post:

    pretzelpretzel (05-06-2019)

  4. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Given the most popular size tub for adult ball pythons is 41qts and given the dimensions of 41qt Sterilite tubs are 34 7/8" L x 16 5/8" W x 6 1/8" H I would dare to say that a 36" x 24" x 15" would be perfectly adequate...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    pretzelpretzel (05-07-2019)

  6. #4
    Registered User reptilemom25's Avatar
    Join Date
    06-18-2018
    Posts
    187
    Thanks
    43
    Thanked 162 Times in 86 Posts
    Images: 1
    What about purchasing a stand for the t10 and putting it in your room?
    0.1 Normal ball python Astrid
    1.0 banana bumblebee Samwise
    1.0 San Mattais rosy boa Charlie
    1.0 bearded dragon Gimli
    1.0 crested gecko Mr. Lizard

  7. The Following User Says Thank You to reptilemom25 For This Useful Post:

    pretzelpretzel (05-07-2019)

  8. #5
    Registered User pretzelpretzel's Avatar
    Join Date
    12-09-2017
    Location
    NEPA
    Posts
    75
    Thanks
    55
    Thanked 21 Times in 16 Posts

    Re: animal plastics advice

    i would do that but my room is very cramped and i would have to remove my dresser, and then i would have no room for my clothes haha


    Sent from my iPhone using Tapatalk

  9. #6
    Registered User reptilemom25's Avatar
    Join Date
    06-18-2018
    Posts
    187
    Thanks
    43
    Thanked 162 Times in 86 Posts
    Images: 1

    Re: animal plastics advice

    Quote Originally Posted by pretzelpretzel View Post
    i would do that but my room is very cramped and i would have to remove my dresser, and then i would have no room for my clothes haha


    Sent from my iPhone using Tapatalk
    Would your parents perhaps consider a larger dresser to accommodate the bigger enclosure?
    0.1 Normal ball python Astrid
    1.0 banana bumblebee Samwise
    1.0 San Mattais rosy boa Charlie
    1.0 bearded dragon Gimli
    1.0 crested gecko Mr. Lizard

  10. The Following User Says Thank You to reptilemom25 For This Useful Post:

    pretzelpretzel (05-07-2019)

  11. #7
    BPnet Veteran
    Join Date
    03-07-2019
    Posts
    810
    Thanks
    206
    Thanked 474 Times in 249 Posts

    Re: animal plastics advice

    Quote Originally Posted by pretzelpretzel View Post
    i would do that but my room is very cramped and i would have to remove my dresser, and then i would have no room for my clothes haha


    Sent from my iPhone using Tapatalk

    In my opinoin snakes > clothes Just walk around nekkid

  12. The Following 2 Users Say Thank You to sur3fir3 For This Useful Post:

    Kerimac (05-10-2020),pretzelpretzel (05-07-2019)

  13. #8
    BPnet Veteran MarkL1561's Avatar
    Join Date
    01-31-2015
    Posts
    401
    Thanks
    435
    Thanked 605 Times in 224 Posts

    Re: animal plastics advice

    I have the enclosures in my bedroom set up on a storage rack I got at Home Depot. I live in a small apartment so I don’t have much space, sounds like you have a similar situation. Definitely something worth checking out as it saves massive amounts of space. My apartment is less than 600 sqft and I have 7 enclosures, all of which are pretty large. The racks can be dressed up with plants and what not to make them more aesthetically pleasing as well


    Sent from my iPhone using Tapatalk

  14. The Following User Says Thank You to MarkL1561 For This Useful Post:

    pretzelpretzel (05-07-2019)

  15. #9
    Registered User pretzelpretzel's Avatar
    Join Date
    12-09-2017
    Location
    NEPA
    Posts
    75
    Thanks
    55
    Thanked 21 Times in 16 Posts

    Re: animal plastics advice

    i wish i could get a larger dresser but it wouldn’t fit in the room..
    thanks everyone for the advice, i have many options to consider now )


    Sent from my iPhone using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1