» Site Navigation
0 members and 688 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Change the length of days between feeding
Should I leave it a bit longer between feeds?
I currently feed him every 7 days, an because he’s getting bigger I don’t know wether to leave it for about 9-10 days. So, is it advisable to do something like this?
Sent from my iPhone using Tapatalk
-
-
Re: Change the length of days between feeding
 Originally Posted by MuicyJelon
Should I leave it a bit longer between feeds?
I currently feed him every 7 days, an because he’s getting bigger I don’t know wether to leave it for about 9-10 days. So, is it advisable to do something like this?
Sent from my iPhone using Tapatalk
I have two adult Royals who will only eat every 14 days ( or so ) ..
Sent from my iPhone using Tapatalk Pro
-
The Following User Says Thank You to Zincubus For This Useful Post:
-
Re: Change the length of days between feeding
 Originally Posted by Zincubus
I have two adult Royals who will only eat every 14 days ( or so ) ..
With the exception of recently hatched babies that are not yet eating consistently, every ball in my collection is fed, at most, once every 14 days. And some of the other animals in my collection got three or four weeks between feedings.
The hobby as a whole tends to overfed. Unless your animal is suffering from serious malnutrition, it can go a couple weeks (or three or four) without a meal
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 8 Users Say Thank You to asplundii For This Useful Post:
Alicia (04-30-2019),ballpythonsrock2 (04-30-2019),bcr229 (04-30-2019),Bogertophis (04-30-2019),Craiga 01453 (04-30-2019),FollowTheSun (04-30-2019),MuicyJelon (04-30-2019),richardhind1972 (04-30-2019)
-
Re: Change the length of days between feeding
As I get to know my snakes better, I am learning to look more for signs of hunger rather than feeding on a schedule. For example staring at me from inside the hide, or actively hunting at night. If it's been a while since a feeding, I cut off the tail of a feeder rat, obviously dead already, and wave it in front of his nose. It will either be ignored or will trigger an immediate interested response.
Sent from my SM-G960U1 using Tapatalk
2 BP's, one ratsnake, 2 dogs, 3 cats, 2 small caged birds, 7 chickens, and a toddler in a pear tree
-
The Following 4 Users Say Thank You to FollowTheSun For This Useful Post:
ballpythonsrock2 (04-30-2019),Bogertophis (04-30-2019),Craiga 01453 (04-30-2019),MuicyJelon (04-30-2019)
-
Re: Change the length of days between feeding
With the exception of my boas, who eat a little less often, I feed my snakes every 5-7 days their 1st year, every 7-10 days their 2nd year, and every 2-4 weeks as adults. They get a few more snacks in the warmer months and eat smaller meals, with less frequency, during the winter.
Last edited by EL-Ziggy; 04-30-2019 at 12:29 PM.
3.0 Carpet Pythons, 1.1 Bullsnakes
1.0 Olive Python 1.0 Scrub Python,
1.0 BI, 0.1 BCO
-
-
Re: Change the length of days between feeding
I feed my snakes when I feel like it. Lol
Seriously though, it varies, sometimes it's once a week, then I may skip a week or two in between. I tend to be more frequent and precise with baby snakes.
Sent from my SM-S727VL using Tapatalk
-
-
There is no magic number for BP feeding other than for snakes less than a year old. There are many of factors involved. Age, sex, breeding or not, and size of meal. I no longer worry about trying to establish a regular feeding schedule for the females but I do have feeding days. Most of my adult males eat once every two weeks. Females that are being bred are allowed to be on a feast or famine routine. I expect all my adults to go off food for 2 to 6 months. For me this seems to produce large healthy clutches. If I was not breeding I would probably drop adult females back to some sort of bi-weekly schedule.
Honest, I only need one more ...
-
The Following 5 Users Say Thank You to JodanOrNoDan For This Useful Post:
Alicia (04-30-2019),Bogertophis (04-30-2019),Craiga 01453 (04-30-2019),EL-Ziggy (04-30-2019),MuicyJelon (04-30-2019)
-
BPnet Veteran
Re: Change the length of days between feeding
When you class your snakes (specifically BPs) as adults are you just going from their age, weight or both?
Sent from my iPhone using Tapatalk
-
-
Re: Change the length of days between feeding
 Originally Posted by MuicyJelon
When you class your snakes (specifically BPs) as adults are you just going from their age, weight or both?
Sent from my iPhone using Tapatalk
Both, but I lean heavily to age. In general, once they enter their second winter they are normally feeding as adults. Boys mature much faster than girls. Girls can still have heavy growth at three winters, some taper off at two. Boys are generally a year ahead of the girls. As far as weight goes, there seems to be something magical that happens to girls around 1000 grams, boys 800 where they go off food. All this of course assumes that the snake is healthy to begin with.
I have taken in older snakes that were underweight for their age. These guys will pound rats sometimes two mediums a week until they get to the weight they want to be, then they will taper off to something normal. With balls, the snake knows how big it wants to be. Last night, an average sized female that laid a 11 egg clutch 2 weeks ago decided she wanted to eat. She wanted two mediums and she got them (that is a lot of food for a ball). She will probably want 2 again next week. After that she will voluntarily go on a one medium a week schedule. Once breeding season rolls around again her feeding habits will change again.
I have never personally had a ball overeat. They seem to reach the size and weight they want to be, then stop eating. I have heard of, but never witnessed a ball that was obese. But, and it is a big but, I only have breeding animals.
Honest, I only need one more ...
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
Bogertophis (04-30-2019),MuicyJelon (04-30-2019)
-
BPnet Veteran
Re: Change the length of days between feeding
 Originally Posted by JodanOrNoDan
Both, but I lean heavily to age. In general, once they enter their second winter they are normally feeding as adults. Boys mature much faster than girls. Girls can still have heavy growth at three winters, some taper off at two. Boys are generally a year ahead of the girls. As far as weight goes, there seems to be something magical that happens to girls around 1000 grams, boys 800 where they go off food. All this of course assumes that the snake is healthy to begin with.
I have taken in older snakes that were underweight for their age. These guys will pound rats sometimes two mediums a week until they get to the weight they want to be, then they will taper off to something normal. With balls, the snake knows how big it wants to be. Last night, an average sized female that laid a 11 egg clutch 2 weeks ago decided she wanted to eat. She wanted two mediums and she got them (that is a lot of food for a ball). She will probably want 2 again next week. After that she will voluntarily go on a one medium a week schedule. Once breeding season rolls around again her feeding habits will change again.
I have never personally had a ball overeat. They seem to reach the size and weight they want to be, then stop eating. I have heard of, but never witnessed a ball that was obese. But, and it is a big but, I only have breeding animals.
Mine’s just under two years old & 690g.
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|