Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 669

0 members and 669 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 11

Threaded View

  1. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Change the length of days between feeding

    Quote Originally Posted by Zincubus View Post
    I have two adult Royals who will only eat every 14 days ( or so ) ..
    With the exception of recently hatched babies that are not yet eating consistently, every ball in my collection is fed, at most, once every 14 days. And some of the other animals in my collection got three or four weeks between feedings.

    The hobby as a whole tends to overfed. Unless your animal is suffering from serious malnutrition, it can go a couple weeks (or three or four) without a meal
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 8 Users Say Thank You to asplundii For This Useful Post:

    Alicia (04-30-2019),ballpythonsrock2 (04-30-2019),bcr229 (04-30-2019),Bogertophis (04-30-2019),Craiga 01453 (04-30-2019),FollowTheSun (04-30-2019),MuicyJelon (04-30-2019),richardhind1972 (04-30-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1