Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 621

0 members and 621 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 19

Thread: A Mystery Snake

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Mystery Snake

    Quote Originally Posted by Eye4Pythons View Post
    In other words, androgenesis results in super forms and since she only has one apparent super form, she only has that morph (if she is, in fact, a product of androgenesis). That's what I got from what you said, anyway. Is that about right or has my simplification overlooked something important?
    Sorry, looking back I did go a little "science lecture mode" there LOL. But yes, that is pretty much the punchline to it.


    Quote Originally Posted by Eye4Pythons View Post
    This is really fascinating. I wish I would have realized as much in my formative years. Oh well. Never too late to learn something new!
    A good policy to live by. I try to pick up something new every day, which is why I have a massive file of scientific articles taking up an enormous amount of file space on my computer LOL
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Eye4Pythons (04-12-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1