Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,124

0 members and 1,124 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Jchipowsky (44)

» Stats

Members: 75,945
Threads: 249,144
Posts: 2,572,366
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 1 of 2 12 LastLast
Results 1 to 10 of 19

Thread: A Mystery Snake

  1. #1
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    A Mystery Snake

    I recently purchased a new female to add to my extremely modest collection. She was advertised as an Enchi 100% het Clown. She looks like a Super Enchi to me (and to her breeder).

    Her parents are 1.0 OD Enchi het Clown and 0.1 visual Clown. I've talked to a few people about her and have been told she could be an Enchi Blade het Clown (meaning the breeder may not know he has some Blade in his collection). This seems like a perfectly reasonable explanation and I do plan to prove her out eventually but I thought I'd ask the rest of you what you thought, in the meantime.

    Whether she's got an extra gene or she's just the coolest looking Enchi I've ever seen, I'm very happy with her. I mean, look at her. She's gorgeous!

    Sent from my Moto G Play using Tapatalk

  2. The Following User Says Thank You to Eye4Pythons For This Useful Post:

    Ronniex2 (04-08-2019)

  3. #2
    BPnet Senior Member Sonny1318's Avatar
    Join Date
    07-02-2014
    Location
    Chicago
    Posts
    2,262
    Thanks
    4,720
    Thanked 1,538 Times in 1,148 Posts
    Images: 9
    Beautiful snake, I’m no expert by any means. But possibly something more then just Enchi. Looking forward to someone with more experience weighing in.
    1.0 Black Pastel Pinstripe
    1.0 Reduced Pattern Clown
    1.0 Low White Pied
    1.0 Hypo Super Enchi

  4. The Following User Says Thank You to Sonny1318 For This Useful Post:

    Eye4Pythons (04-12-2019)

  5. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Certainly looks like a SuperEnchi... Possible this is a case of androgenesis. And if that is the case then she will also prove to not be het Clown
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Eye4Pythons (04-12-2019),Lord Sorril (04-05-2019)

  7. #4
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: A Mystery Snake

    Quote Originally Posted by asplundii View Post
    Certainly looks like a SuperEnchi... Possible this is a case of androgenesis. And if that is the case then she will also prove to not be het Clown
    See, I hadn't thought of that. I (with my incredibly basic understanding of such things) thought that androgenesis acted like parthenogenesis, except taking the genetics from the male instead of the female. If the father is an OD Enchi het Clown, how would he produce a baby that is Super Enchi and without the possibility of being het Clown?

    Forgive my ignorance. I'm no geneticist by any means (which I'm beginning to feel is a failing on my part). I'm certainly looking to learn more, though.

    - Charles Eye

  8. #5
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,946
    Thanks
    893
    Thanked 4,181 Times in 1,552 Posts
    Images: 120

    Re: A Mystery Snake

    It is also possible:
    -The female Clown is a non-expressive Enchi.
    -The Super Enchi is a result of retained sperm from the prior year.
    -Or the breeder got his notes mixed up.

    Although I like the Androgenesis theory. Sounds so much cooler!
    *.* TNTC

  9. The Following User Says Thank You to Lord Sorril For This Useful Post:

    Eye4Pythons (04-12-2019)

  10. #6
    BPnet Senior Member Lord Sorril's Avatar
    Join Date
    03-05-2018
    Location
    Massachusetts - USA
    Posts
    1,946
    Thanks
    893
    Thanked 4,181 Times in 1,552 Posts
    Images: 120

    Re: A Mystery Snake

    Scratch that 'Retained Sperm Theory' -- Can't make a Super Enchi without both parties being Enchi to start with.
    *.* TNTC

  11. #7
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: A Mystery Snake

    Quote Originally Posted by Lord Sorril View Post
    Scratch that 'Retained Sperm Theory' -- Can't make a Super Enchi without both parties being Enchi to start with.
    No but your other thoughts on the subject are sound. I would be quite happy to find out that her mother is just low expression. I know I've seen plenty of reduced Clowns for sale that looked very much like low expression Enchi Clowns. If HER breeder wasn't confident enough to call her an Enchi Clown, it's quite possible she was sold off as just a reduced Clown.

    These kinds of things are a lot of fun for me. I get to enjoy the guessing game while I'm waiting to prove her out. I could have bought any number of Enchi het Clowns for my project but this girl has secrets to uncover and I want to be the one to do so. No matter what, she's gonna make some pretty babies!

    - Charles Eye

  12. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Mystery Snake

    Quote Originally Posted by Eye4Pythons View Post
    See, I hadn't thought of that. I (with my incredibly basic understanding of such things) thought that androgenesis acted like parthenogenesis, except taking the genetics from the male instead of the female. If the father is an OD Enchi het Clown, how would he produce a baby that is Super Enchi and without the possibility of being het Clown?

    Forgive my ignorance. I'm no geneticist by any means (which I'm beginning to feel is a failing on my part). I'm certainly looking to learn more, though.
    Unless it is purposeful, ignorance is nothing you need to ask forgiveness for. All of us have areas where we have strengths and areas where we have weaknesses. Acknowledging ignorance is just taking the first step to learning. So I applaud you for not just recognizing where you are weak but looking to change that by learning. That is something to be proud of, not apologize for.

    Now... To answer your question.

    If the sire was an Enchi OD het Clown then genetically he would be EeOoCc. During gametogenesis, the genetic payload in the sperm contain only one copy of each chromosome, ergo only one copy of each gene. This means that the possible sperm from the father are:

    EOC
    EOc
    Eoc
    EoC
    eOC
    eOc
    eoc
    eoC

    When androgenesis happens, the sperm (typically) penetrates an egg that has no genetic payload and the first act that occurs is an automatic doubling of the sperm's genetic package. This makes the embryo homozygous for whatever genes it is carrying. So if the sperm had carried the Clown gene then a homozygous embryo would, of course, be a visual Clown. Because your animal is not a visual Clown (and assuming androgenesis is at play here) then we know that the sperm responsible was not carrying the Clown gene. Likewise, because your animal is not a SuperOD we know the sperm did not carry the OD gene. This means the sperm was EoC, which when doubled makes EEooCC - homozygous Ench at Enchi locus, homozygous WT at OD locus, and homozygous WT at Clown locus.


    Make sense?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Eye4Pythons (04-12-2019),pbenner (04-08-2019)

  14. #9
    BPnet Veteran
    Join Date
    12-10-2015
    Location
    Collegeville, Pennsylvania
    Posts
    229
    Thanks
    11
    Thanked 169 Times in 99 Posts

    Re: A Mystery Snake

    My enchi het clown looks exactly like yours, she came from a lazik line clown and I have a friend who has a het clown who is also very very bright. Sometimes the het influences the look of the snake.

  15. The Following 3 Users Say Thank You to mdb730 For This Useful Post:

    Eye4Pythons (04-12-2019),Godzilla78 (04-05-2019),Ronniex2 (04-08-2019)

  16. #10
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: A Mystery Snake

    Quote Originally Posted by asplundii View Post
    Unless it is purposeful, ignorance is nothing you need to ask forgiveness for. All of us have areas where we have strengths and areas where we have weaknesses. Acknowledging ignorance is just taking the first step to learning. So I applaud you for not just recognizing where you are weak but looking to change that by learning. That is something to be proud of, not apologize for.

    Now... To answer your question.

    If the sire was an Enchi OD het Clown then genetically he would be EeOoCc. During gametogenesis, the genetic payload in the sperm contain only one copy of each chromosome, ergo only one copy of each gene. This means that the possible sperm from the father are:

    EOC
    EOc
    Eoc
    EoC
    eOC
    eOc
    eoc
    eoC

    When androgenesis happens, the sperm (typically) penetrates an egg that has no genetic payload and the first act that occurs is an automatic doubling of the sperm's genetic package. This makes the embryo homozygous for whatever genes it is carrying. So if the sperm had carried the Clown gene then a homozygous embryo would, of course, be a visual Clown. Because your animal is not a visual Clown (and assuming androgenesis is at play here) then we know that the sperm responsible was not carrying the Clown gene. Likewise, because your animal is not a SuperOD we know the sperm did not carry the OD gene. This means the sperm was EoC, which when doubled makes EEooCC - homozygous Ench at Enchi locus, homozygous WT at OD locus, and homozygous WT at Clown locus.


    Make sense?
    In other words, androgenesis results in super forms and since she only has one apparent super form, she only has that morph (if she is, in fact, a product of androgenesis). That's what I got from what you said, anyway. Is that about right or has my simplification overlooked something important?

    This is really fascinating. I wish I would have realized as much in my formative years. Oh well. Never too late to learn something new!

    - Charles Eye

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1