Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 723

0 members and 723 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 19

Thread: A Mystery Snake

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: A Mystery Snake

    Quote Originally Posted by Eye4Pythons View Post
    See, I hadn't thought of that. I (with my incredibly basic understanding of such things) thought that androgenesis acted like parthenogenesis, except taking the genetics from the male instead of the female. If the father is an OD Enchi het Clown, how would he produce a baby that is Super Enchi and without the possibility of being het Clown?

    Forgive my ignorance. I'm no geneticist by any means (which I'm beginning to feel is a failing on my part). I'm certainly looking to learn more, though.
    Unless it is purposeful, ignorance is nothing you need to ask forgiveness for. All of us have areas where we have strengths and areas where we have weaknesses. Acknowledging ignorance is just taking the first step to learning. So I applaud you for not just recognizing where you are weak but looking to change that by learning. That is something to be proud of, not apologize for.

    Now... To answer your question.

    If the sire was an Enchi OD het Clown then genetically he would be EeOoCc. During gametogenesis, the genetic payload in the sperm contain only one copy of each chromosome, ergo only one copy of each gene. This means that the possible sperm from the father are:

    EOC
    EOc
    Eoc
    EoC
    eOC
    eOc
    eoc
    eoC

    When androgenesis happens, the sperm (typically) penetrates an egg that has no genetic payload and the first act that occurs is an automatic doubling of the sperm's genetic package. This makes the embryo homozygous for whatever genes it is carrying. So if the sperm had carried the Clown gene then a homozygous embryo would, of course, be a visual Clown. Because your animal is not a visual Clown (and assuming androgenesis is at play here) then we know that the sperm responsible was not carrying the Clown gene. Likewise, because your animal is not a SuperOD we know the sperm did not carry the OD gene. This means the sperm was EoC, which when doubled makes EEooCC - homozygous Ench at Enchi locus, homozygous WT at OD locus, and homozygous WT at Clown locus.


    Make sense?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Eye4Pythons (04-12-2019),pbenner (04-08-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1