Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 816

0 members and 816 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,090
Threads: 249,229
Posts: 2,572,847
Top Poster: JLC (31,651)
Welcome to our newest member, GhostsnSnakes
Page 4 of 5 FirstFirst 12345 LastLast
Results 31 to 40 of 49

Thread: Making a BEL.

  1. #31
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    You cannot "add colour" in a Butter/Mojave. Fire, when added to a BluEL will, as I mentioned above, be more likely to push you to a whiter snake without the dorsal stripe. Cinny, does not seem to do much one way or the other when added to a BluEL.

    In "dirty" BluELs (SuperPhantoms, Crystals, SuperMojaves, etc.) you can sometimes tweak pigmentation but it is almost always toward further lightening them. I cannot think of a "dirty" combo that I have seen where it was made darker...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (11-20-2022)

  3. #32
    Registered User ShawarmaPoutine's Avatar
    Join Date
    07-05-2018
    Posts
    128
    Thanks
    77
    Thanked 60 Times in 39 Posts
    Images: 2

    Making a BEL.

    Quote Originally Posted by asplundii View Post
    You cannot "add colour" in a Butter/Mojave. Fire, when added to a BluEL will, as I mentioned above, be more likely to push you to a whiter snake without the dorsal stripe. Cinny, does not seem to do much one way or the other when added to a BluEL.

    In "dirty" BluELs (SuperPhantoms, Crystals, SuperMojaves, etc.) you can sometimes tweak pigmentation but it is almost always toward further lightening them. I cannot think of a "dirty" combo that I have seen where it was made darker...
    Does a phantom x butter make a clean white snake?

    What I’ve been researching for the past 4 hours is the best pairing to get BELs 100% of the time by breeding a BEL x BEL.

    So far I am thinking (Mojave|lesser) x (phantom|butter).

    There is a 25 chance that one of BELs will be a lesser|Butter and may have bug eyes but that’s better than pairing a Butter to a Lesser in the first place.
    Last edited by ShawarmaPoutine; 04-01-2019 at 10:19 AM.

  4. #33
    Registered User ShawarmaPoutine's Avatar
    Join Date
    07-05-2018
    Posts
    128
    Thanks
    77
    Thanked 60 Times in 39 Posts
    Images: 2

    Re: Making a BEL.

    Has anybody proven whether or not Bug eyes are genetic and will be passed to offspring?

    There's a 7 month old BEL(Super Lesser) Female whose dad was a BEL(Super Lesser) and who’s mom was a Lesser (yikes, so much lesser). She has Bug eyes and I was wondering if it carries over genetically. The breeder over a website similar to craigslist said that he’s produced 14 BELs by breeding this super lesser male to 2 Lesser females and this one is the only one with bug eyes.




  5. The Following User Says Thank You to ShawarmaPoutine For This Useful Post:

    Ronniex2 (11-20-2022)

  6. #34
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by ShawarmaPoutine View Post
    Does a phantom x butter make a clean white snake?
    Butter/Phantom is a Karma. Sometimes they are white, sometimes they display a faint pattern. Check out RDR's breeding pages from 2015 or so, he has a great pic showing a full clutch of Karma that run the gambit


    Quote Originally Posted by ShawarmaPoutine View Post
    Has anybody proven whether or not Bug eyes are genetic and will be passed to offspring?
    It is genetic in as much as it is a secondary phenotype that occurs with increased appearance when breeding for SuperLesser. Just because the parent does not have it does not mean the offspring will not have it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (11-20-2022)

  8. #35
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Making a BEL.

    A secondary question: Is there anything I can do to minimize the chance of getting bug-eyed baby ball pythons?

    Some online suggestions for minimizing the probability of congenital anomalies in a human baby:
    Eat a healthy diet
    Maintain a healthy weight.
    Get 400 micrograms of folic acid daily
    Avoid exposure to harmful substances, including secondary smoke
    Take a daily vitamin

    Seems to me that many of these suggestions for a healthy human baby would be true for ball pythons, too.

    Dave Barker of VPI recommends avoiding obesity in ball pythons.

    Besides humans, breeder trout, chickens and pigs need higher levels of vitamins than nonbreeders. Do breeder ball pythons? IMO, highly likely.

    Adequate folic acid minimizes the risk of brain and spinal cord defects in humans. The embryonic retina is an outgrowth of brain tissue. Folic acid in found in some green leafy vegetables, nuts, beans, and citrus fruits. Do ball python embryos need folic acid? If so, how much? The ball python's standard diet in captivity is usually rats or mice. How high is the folic acid content in rats and mice? Do African rodents gut load themselves with greens at a time when ball python follicles are developing? I sure don't know the answers.

    So there is some food for thought. Good luck.

  9. The Following User Says Thank You to paulh For This Useful Post:

    ShawarmaPoutine (04-03-2019)

  10. #36
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by paulh View Post
    A secondary question: Is there anything I can do to minimize the chance of getting bug-eyed baby ball pythons?
    The simple answer is to just not breed the morphs that are prone to it.


    Quote Originally Posted by paulh View Post
    A secondary question: Is there anything I can do to minimize the chance of getting bug-eyed baby ball pythons?

    Some online suggestions for minimizing the probability of congenital anomalies in a human baby:

    ...

    Dave Barker of VPI recommends avoiding obesity in ball pythons.

    Besides humans, breeder trout, chickens and pigs need higher levels of vitamins than nonbreeders. Do breeder ball pythons?

    ...

    Do African rodents gut load themselves with greens at a time when ball python follicles are developing? I sure don't know the answers.

    So there is some food for thought. Good luck.

    I get the point you are making and I do not necessarily refute it but I offer up a few thoughts playing devil's advocate:

    -While rodent breeders do not necessarily gut-load, most commercial rodent diets have been balanced to provide/meet the needs of the rodents so they are, in effect, being gut loaded.
    -If nutrient-deficiencies in our animals were the cause of the bug-eyes then should we not be seeing bug-eyes occurring across the spectrum of our hatchlings and not only among very specific morph combinations?
    -I fully agree with Dave that obesity should be avoided (in all snakes, not just balls) but again, if obesity were a contributing cause then should we not be seeing a much higher instance of defects across the board in our breeding because if we are being brutally honest most keepers do overfeed their animals?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Lord Sorril (04-03-2019),paulh (04-04-2019)

  12. #37
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21
    Hooray, a Devil's Advocate! Maybe you can help me out with questions I've wondered about. I have many more questions than answers.

    Do the needs of the rodents equal the needs of breeder and baby snakes? Wild fox snakes have raided my father's pigeon cages for eggs. Wild corn snakes and bullsnakes like eggs, too. Do eggs have some benefit that rodent prey lacks?

    Do the commercial rodent breeders let the rodents sit around for a few hours without food between selection for killing and killing/freezing? This could reduce any gut-loading effect from the pellets. And food pellets slowly oxidize and lose vitamin content. Do the rodent breeders always use the pellets before expiration date? These are questions I cannot answer but which could affect the snakes' nutrition.

    Why do some breeders produce fewer bugeyed snakes than others? Sheer luck alone? Could a snake with a specific morph need a higher level of a specific nutrient to develop than a normal snake, and some breeders, by luck, do a better job of catering to that need?

    Bugeyes are fairly common in homozygous lesser ball pythons and homozygous leucistic rat snakes. These are (probably) different genes in different snake families, but both produce blue eyed leucistics, some of which are bugeyed. Are these genes in the same biosynthetic pathway?

    I think we are seeing a higher instance of defects in captive breeding compared to wild breeding. A higher percentage of slugs, vertebral kinks and small/missing eyes as well as bug eyes. This is across the board as well as in specific morphs.

  13. The Following User Says Thank You to paulh For This Useful Post:

    ShawarmaPoutine (04-04-2019)

  14. #38
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: Making a BEL.

    Quote Originally Posted by paulh View Post
    I think we are seeing a higher instance of defects in captive breeding compared to wild breeding. A higher percentage of slugs, vertebral kinks and small/missing eyes as well as bug eyes. This is across the board as well as in specific morphs.
    I think that has more to do with the number of BPs being bred in captivity compared to in the wild, and the fact that we're bringing a much higher percentage to term. Plus, there _is_ the whole 'you don't have to do anything more than buy two snakes in order to attempt to breed' thing. I'd dare say there's a noteworthy percentage of new breeders who are less than fully prepared when they start. That doesn't exactly help the overall success rate.


    Sent from my Moto G Play using Tapatalk
    Last edited by Eye4Pythons; 04-04-2019 at 10:22 PM.

  15. #39
    Registered User ShawarmaPoutine's Avatar
    Join Date
    07-05-2018
    Posts
    128
    Thanks
    77
    Thanked 60 Times in 39 Posts
    Images: 2

    Re: Making a BEL.

    Quote Originally Posted by Eye4Pythons View Post
    I think that has more to do with the number of BPs being bred in captivity compared to in the wild, and the fact that we're bringing a much higher percentage to term. Plus, there _is_ the whole 'you don't have to do anything more than buy two snakes in order to attempt to breed' thing. I'd dare say there's a noteworthy percentage of new breeders who are less than fully prepared when they start. That doesn't exactly help the overall success rate.


    Sent from my Moto G Play using Tapatalk
    What’s are the things many noobs ignore when thinking “you don’t have to do anything more than buying two snakes in order to attempt to breed.”


    Sent from my iPhone using Tapatalk

  16. #40
    Registered User Eye4Pythons's Avatar
    Join Date
    02-13-2019
    Posts
    21
    Thanks
    43
    Thanked 19 Times in 10 Posts

    Re: Making a BEL.

    Quote Originally Posted by ShawarmaPoutine View Post
    What’s are the things many noobs ignore when thinking “you don’t have to do anything more than buying two snakes in order to attempt to breed.”


    Sent from my iPhone using Tapatalk
    That's a long list that I don't care to hurt myself thinking about. I'm a year in on ownership, probably at least two years from doing any actual breeding, have put in hundreds upon hundreds of hours in researching and still don't know that I'll be well versed enough to be "ready" by the time my snakes are. I'll be holding off until I'm confident in my knowledge on the subject and I've seen quite a few who jumped in with far less knowledge than I have currently (which again, I don't feel is nearly enough, yet).

    The results I've seen from such haste has been quite mixed. Some people get it right, straight out of the gate. Others have entirely bad clutches. None of this is any kind of judgement, other than to say it's reasonable to believe that more people doing more research before they start breeding would result in higher initial success (and less reported birth defects, overall).

    - Charles Eye

Page 4 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1