» Site Navigation
0 members and 1,257 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,128
Posts: 2,572,277
Top Poster: JLC (31,651)
|
-
Registered User
What is it like to own a BEL?
Hi, I was wondering what it is like owning a BEL. I'm getting one next Saturday and want to be prepared. I've heard it's harder to tell when they go into shed and what not. Hoping to hear from people who have some experience with this morph. Thank you!
-
-
Re: What is it like to own a BEL?
I’ve had mine about 2 months and yea I never noticed him going into shed until I found the actual shed.
Sent from my iPhone using Tapatalk
BS in Animal Science- Future Exotic Veterinarian
1.0 X Karma BEL- Apollo
1.0 X Mystic x Ghost- Kronos
0.1 X Invisiball Spider- Medusa
-
-
I've kept other albino snakes, but not a BEL; either way, yes...shed cycles can easily get by you but it gets easier with practice. My personal method is to shine
a small flashlight beam onto the curve of their eyes in a dark room...there's a huge difference between "blue" & normal, you'll see.
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: What is it like to own a BEL?
I don't think it's any more difficult to discern impending shed with my BEL than it is my other snakes. It's possibly even a bit easier because she tends to go light pink all over instead of just on her belly. Her eyes also go fully opaque despite them being blue.
Now personality-wise, my BEL is kind of a jerk lol. She was one of my bucket list BP's and is now the only BP I have to take care not to get tagged by. Here's hoping she settles down eventually.
BALL PYTHONS: 1.0 Pied/Clark, 1.0 Pastel Vanilla Super Stripe/Sunny, 0.1 Dragon Fly/Buffy, 0.1 Pastel Vanilla Yellow Belly/Cher, 0.1 BEL (Mojave Lesser)/Arya, 0.0.1 Normal/Norm, 0.1 Cinnamon Enchi/Peaches, 1.0 Cinnamon Calico/Yoshi, 0.1 Pewter Het Dreamsicle/Ariel
BOAS: 0.1 Dumeril's/Memphis, 0.1 BCL/Artemis, 1.0 BCO/Grimm, 0.1 Suriname BCC/Rhubarb
CORN SNAKES: 0.0.1/Mushu
MORELIA: 0.1 Bredli/Zelda, 0.1 Granite IJ/Bridget, 0.1 Caramel Diamond Jungle/Pixie
-
The Following 2 Users Say Thank You to WhompingWillow For This Useful Post:
Bogertophis (03-17-2019),Kamr (03-20-2019)
-
I have never had a problem determining when my BluELs (or BlkELs or Ivories) were going to shed. They opaque out just like every ball, the eyes cloud over and, as Whomp noted, they often get a full body pink flush.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
I don't have a BEL but I'm wondering if their bellies get pink like other snakes right before shed?
edited: nevermind I just read the post above mine
Last edited by FollowTheSun; 03-18-2019 at 10:00 AM.
2 BP's, one ratsnake, 2 dogs, 3 cats, 2 small caged birds, 7 chickens, and a toddler in a pear tree
-
-
Re: What is it like to own a BEL?
 Originally Posted by FollowTheSun
I don't have a BEL but I'm wondering if their bellies get pink like other snakes right before shed?
edited: nevermind I just read the post above mine
My Albino royals don’t but my Pied does get a pink belly ..
Sent from my iPhone using Tapatalk Pro
-
-
Same as owning anything else when it comes to shed, belly becomes reddish and eyes become clowdy.
The only difference is to keep a white snake white
-
-
Registered User
Thanks everyone for the replies ! Is it harder to keep them clean ? I'm going to be using Cypress mulch in her tub . Everything is set up and I'm currently letting it run for a few days (6) to make sure it heats well before she arrives. She will be at the bottom of the rack. Not sure how many quarts her tub is but I was told it could fit a full grown male. My biggest ball is 402g so I haven't experienced an adult being in the tub yet. They all have room to move around. Really excited to have my first all white ball python and I appreciate the help from you guys.
Was also wondering if the pink hue while going into shed will stay when she's an adult? She's 237g as of yesterday. Breeder said she shed a few weeks ago so I should expect her to shed soon. I can see where the pink belly will be easier to spot on her since she is white, not sure why I didn't think of that as it is how I can tell on my other bps. Think I was thinking more along the lines of the eyes being a lighter blue shade.
-
-
Registered User
Re: What is it like to own a BEL?
Here is a picture of her currently. 
Sent from my HTCD160LVWPP using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|