» Site Navigation
2 members and 1,718 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,087
Threads: 249,227
Posts: 2,572,845
Top Poster: JLC (31,651)
|
-
Registered User
New to Morphology -- Co-occurence of Genes
Hey there! I have always loved snakes and genetics, having previously kept a few small breeds casually and having been obsessed with horse genetics, but I recently discovered BP morphology and breeding as a serious hobby after attending a few expos and I'm hooked! I don't have a BP right now but I am researching as much as I can to hopefully dive into breeding in the future. I'm super psyched about the idea, I had no idea there was so much possibility!
My main question: Can any morph occur with any other morph? Or are there some that are mutually exclusive? Right now it seems to me like you can have an endless combination of genetic mutations in one snake alone, and all you need to know in order to understand all of BP morphology is just how to identify different morphs and whether each one dominant or co-dominant or recessive. Is that true or are there any complications to that?
I've read most of the genetics resources this site recommends, but are there any other resources you all would recommend? What are the best ways for me to learn and to make a plan for breeding in the future? Obviously caretaking is of the utmost importance for me to learn before advancing (and this is definitely a few years off at the moment anyway) but what are the best steps for me to take as a brand-new beginner, assuming I know a bit about caring for snakes? What are valuable morphs to start with in your breeding career? Do you all imagine a certain combination you haven't seen before and try to plan your breeding stock for that? Also random, but if I were to purchase a female or two, could I hire a "stud" to begin, or do you all generally breed within your own collections?
I'm excited to learn all I can and to meet other people who love pythons!
-
-
Registered User
Re: New to Morphology -- Co-occurence of Genes
One way to learn about the morphs and how they interact is to go to morphmarket . Com and have a look at whats for sale. This does a few things, helps you see what you personally like and feel passionate about, any bp breeder will tell you breed what morphs you love. The other is that with the gene and trait lists, you can familiarize yourself with most all morphs and how they interact with each other.
2nd resource, youtube. I suggest checking out royal constrictor designs, balls2u, and justin kolbylka as good channels to check out. there is a wealth of information on care, breeding and each of them do spotlight videos on a single morphs. They also do vids explaining genetics such as co doms and recessives ect.
I won't list the genes, as the info is to be found many places but there are some morphs that have lethal reactions to each other and can cause a number of defects down to death before even hatching. Balls2u has a vid on that. And theres threads on it on here also.
This forum is chalk full of info too, if youre as obsessed as me, you'll spend hours reading and perusing here lol.
I have seen a lot of breeders interviews and they often suggest starting with recessives.. so look at the morphs, find a recessive project or 2 you love and want to work with, and go from there.. get a het or a visual and if you can, get a co dom with a het gene thrown in. Combos of co doms and recessives seem to be the future.
One last thing, i am by no means a breeder or a pro or anything, this is just stuff I've gathered and learned and have found useful to me sorry for the wall of text.
Sent from my SM-N960U using Tapatalk
-
The Following User Says Thank You to Roux For This Useful Post:
-
Re: New to Morphology -- Co-occurence of Genes
 Originally Posted by soapapilla
My main question: Can any morph occur with any other morph? Or are there some that are mutually exclusive? [...] Is that true or are there any complications to that?!
With the exception of Blackhead you cannot combine the alleles of the Spider group (Spider, Champagne, HGW) or you get a dead combo.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: New to Morphology -- Co-occurence of Genes
Thanks so much guys! I appreciate the info and advice and all the resources! I'm excited to look into them more!
Follow up/similar question: I was just reading about how there are different names for the albino morphs, axanthic morphs, and pastel morphs. So, from what I understand, different kinds of pastels have the same genes so if you have a black pastel with a super pastel you have Pp x pp = 50% pastel (Pp) and 50% super pastel (pp). But then for albino and axanthic, different bloodlines within those designations are incompatible, so for instance if you had an albino and a lavender albino, you would have AA x LL = 100% Normals, all Het albino and Het lavender albino since it is recessive and you don't have a copy of the same gene from both parents. Am I thinking about this the right way?
Are there more instances like this that I should know about? I was reading how there are several morphs that can result in a blue-eyed leucistic as well because they are all similarly related. Getting more complicated!
-
-
-
-
Registered User
Re: New to Morphology -- Co-occurence of Genes
If you do a search for bel or blue eye complex on here or YouTube, you'll find a list of what morphs fit into that category. It seems complicated, but the more you learn and familiarize with morphs, it all makes sense and doesn't feel tricky over time.
There are several different pastel lines out there but now days most everyone just calls them pastels.. the only one i see differentiated now is the citrus line.
Black pastel musnt be confused, it is a totally separate gene and is very different from pastel. Morph market pictures are your friends, look one morph up, then the other, and compare the differences.
Most albinos aren't compatible, so a visual A x visual B will create double het offspring that look like normals.
However there are 2 i know of that are allelic to each other. Check out allelic morphs sometime, theres vids on that too and lots on here.
Hope this helped, a lot of this is just stuff you gather from learning and looking things up and putting it all together in your head...or make notes if you learn that way haha.
Sent from my SM-N960U using Tapatalk
-
-
Registered User
Re: New to Morphology -- Co-occurence of Genes
As Roux said, utilize the Ball Python Morph Market. If you need an idea on what offspring may be produced from a pairing. I recommend using their Calculator (Should be the 4th and last tab to the right after "Stores").
-
-
Re: New to Morphology -- Co-occurence of Genes
 Originally Posted by soapapilla
I was just reading about how there are different names for the albino morphs
 Originally Posted by Roux
Most albinos aren't compatible, so a visual A x visual B will create double het offspring that look like normals.
However there are 2 i know of that are allelic to each other. Check out allelic morphs sometime, theres vids on that too and lots on here.
Albino and Candy/Toffee are allelic
Ultramel, Crider, and Burgundy Albino are allelic (there is speculation that Monarch may be in this group as well, but so far no one has done the breeding to prove it)
There are multiple different lines of Caramel that have originated from different imported animals but all are called Caramel
Likewise, there are multiple different lines of Lav that have originated from different imported animals but all are called Lav
 Originally Posted by soapapilla
axanthic morphs
There are, to date, five different types of Axanthinc that have been prove to not be compatible with one another: VPI, TSK, Joliff, Markus Jayne, and BlackAx
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|