Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,156

1 members and 1,155 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,143
Posts: 2,572,365
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 8 of 8

Threaded View

  1. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New to Morphology -- Co-occurence of Genes

    Quote Originally Posted by soapapilla View Post
    My main question: Can any morph occur with any other morph? Or are there some that are mutually exclusive? [...] Is that true or are there any complications to that?!
    With the exception of Blackhead you cannot combine the alleles of the Spider group (Spider, Champagne, HGW) or you get a dead combo.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    soapapilla (03-04-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1