Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 650

1 members and 649 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,900
Threads: 249,096
Posts: 2,572,067
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 7 of 7
  1. #1
    Registered User
    Join Date
    02-20-2019
    Posts
    22
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Morph - ID Possible?

    Hi,

    I bought 2 Ball Pythons a month ago but neither of them had an 100% morph ID and the store didn’t knew it either.

    Is it possible to ID them or do I really need to breed them in order to know for sure (I am already breeding them either way).

    The small one is a Phantom/Mojave Pinstripe, not knowing if a Phantom or a Mojave.


    The big one is a Emperor Pinstripe, not knowing which morphs are creating the Emperor.


    Thanks in advance,

    Best Regards,

    Hugo


    Enviado do meu iPhone usando o Tapatalk

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Phantom and Mojave combined with Pin are difficult to call... Tentatively I would call yours a Mojave Pin but lighting is not great and that can make a difference. Honestly, I would want to have a hands on to be able to most reliably call it.

    Emperor is a Lesser Pastel Pin
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    Registered User
    Join Date
    02-20-2019
    Posts
    22
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Morph - ID Possible?

    Quote Originally Posted by asplundii View Post
    Phantom and Mojave combined with Pin are difficult to call... Tentatively I would call yours a Mojave Pin but lighting is not great and that can make a difference. Honestly, I would want to have a hands on to be able to most reliably call it.

    Emperor is a Lesser Pastel Pin
    Hinwas told by a breeder that the Emperor could be Butter/Lesser Pastel os even just Lesser Pastel, is this info correct or it would be definitly Lesser Pastel?

    Thanks for Your help in both. If it helps, herde you have more photos of it.







    Enviado do meu iPad usando o Tapatalk

  4. #4
    Registered User
    Join Date
    02-20-2019
    Posts
    22
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Morph - ID Possible?

    *I meant just a Lesser Pinstripe (the info a breeder gave me about the óptimos)


    Enviado do meu iPad usando o Tapatalk

  5. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Morph - ID Possible?

    Quote Originally Posted by ERA View Post
    Hinwas told by a breeder that the Emperor could be Butter/Lesser Pastel os even just Lesser Pastel, is this info correct or it would be definitly Lesser Pastel?.
    Butter and Lesser are just different lines of the same morph (just like Bananan and Coral Glow). In a case where you 100% know the lineage then it is probably best to maintain that name but in a case like yours where the lineage is unknown you can call it which ever you want - Butter Pastel Pin or Lesser Pastel Pin. In the grand scheme of things it does not matter either way


    Quote Originally Posted by ERA View Post
    Thanks for Your help in both. If it helps, herde you have more photos of it.
    Still tricky given how close Phantom and Mojave are. I am inclined to stand by Mojave Pin. If it really matters to you then the best thing to do would be to raise it up and breed to a known Mojave. If you get a BluEL then you will know it is a Mojave and if you get a Purple Passion then it is a Phantom
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #6
    Registered User
    Join Date
    02-20-2019
    Posts
    22
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Morph - ID Possible?

    Quote Originally Posted by asplundii View Post
    Butter and Lesser are just different lines of the same morph (just like Bananan and Coral Glow). In a case where you 100% know the lineage then it is probably best to maintain that name but in a case like yours where the lineage is unknown you can call it which ever you want - Butter Pastel Pin or Lesser Pastel Pin. In the grand scheme of things it does not matter either way




    Still tricky given how close Phantom and Mojave are. I am inclined to stand by Mojave Pin. If it really matters to you then the best thing to do would be to raise it up and breed to a known Mojave. If you get a BluEL then you will know it is a Mojave and if you get a Purple Passion then it is a Phantom
    Oh ok, I didn’t knew that about the butter/lesser. Thanks for all that info!

    Yes, I’ll be breeding them, going to start next season. I wasn’t aware at the time about the meaning of the “/“ and the guy from the expo told me it had Mojave AND Phatom so I bought it because I was looking for a female Mojave. Just afterward a breeder friend of mine explained that it was one OR the other, not both.

    Just hope you are wright, I was looking to produce a BEL for a first Goal

    Thanks again for your feedback!



    Enviado do meu iPhone usando o Tapatalk

  7. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Morph - ID Possible?

    Quote Originally Posted by ERA View Post
    Just hope you are wright, I was looking to produce a BEL for a first Goal

    Thanks again for your feedback!
    Glad to be of help.

    And if I am wrong and your animal does turn out to be a Phantom take heart that the PassionPin is still a pretty cool looking animal:

    https://ball-pythons.net/forums/show...=1#post2497489
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1