» Site Navigation
1 members and 1,873 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,069
Threads: 249,219
Posts: 2,572,797
Top Poster: JLC (31,651)
|
-
Re: Spider Morph Head Wobble Hypothesis
 Originally Posted by alittleFREE
Check out Rare Genetics Inc. They are doing a lot of work with snake DNA sequencing.
Sent from my iPhone using Tapatalk
I wonder how accurate this is? Would be cool to see results and explanation of their meaning. Might be worth doing once.
-
The Following User Says Thank You to Skyrivers For This Useful Post:
-
Re: Spider Morph Head Wobble Hypothesis
 Originally Posted by Natural
Even if we did PCR, we’d still have to get it sequenced since PCR would just create the necessary amount of DNA for sequencing but wouldn’t actually give us any information. Sequencing is what actually costs a lot, and without sequencing we’d have no idea where the mutation lies. Even then we’d need to sequence several normal and spider ball pythons in order to make better supported comparisons and be able to eliminate genetic background noise between the individuals.
You would not necessarily have to get it sequenced. And indel in the gen would generate a product of a different length than the WT and this would resolve as a band with altered mobility on a gel. This is basically what they did for locating the mutation in Albino corn snakes:
https://www.nature.com/articles/srep17118/figures/3
And even if you did have to get the amplicon sequenced, no, sequencing does not cost a lot. Amplicon sequencing might cost you a couple hundred bucks. And then all you would have to do is run a BLAST alignment
 Originally Posted by alittleFREE
Check out Rare Genetics Inc. They are doing a lot of work with snake DNA sequencing.
This is not the kind of work Ben is doing. He could probably knock it together, but I am not sure the impetus would be there for him
Last edited by mlededee; 02-27-2019 at 03:27 AM.
Reason: Fixed link
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Spider Morph Head Wobble Hypothesis
This is not the kind of work Ben is doing. He could probably knock it together, but I am not sure the impetus would be there for him
When I said “check out,” I wasn’t suggesting to try to send a shed to him and have him solve the issue, lol. I was just trying to let people know there ARE groups currently working on projects regarding snake DNA; right now it’s mostly about sex determination, but in the future, who knows how far that work will extend. Ben’s talked about trying to identify genetic markers for localities, etc, down the line, but mentioned that where they go with their efforts will largely depend on funding and public interest. Thus it stands to reason if enough people are interested in determining the cause of conditions such as the wobble prevalent in mutations like Jaguar in carpets and Spider in BPs, that could be an avenue they eventually explore.
Sent from my iPhone using Tapatalk
- Summer
0.1 Bearded Dragon ("Reka")
0.1 California Kingsnake ("Cleo")
0.1 Cinnamon Spider Het. Albino Ball Python ("Syd")
1.0 Hypo Bredl’s Python (“Oz”)
-
-
Registered User
Re: Spider Morph Head Wobble Hypothesis
 Originally Posted by asplundii
You would not necessarily have to get it sequenced. And indel in the gen would generate a product of a different length than the WT and this would resolve as a band with altered mobility on a gel. This is basically what they did for locating the mutation in Albino corn snakes:
And even if you did have to get the amplicon sequenced, no, sequencing does not cost a lot. Amplicon sequencing might cost you a couple hundred bucks. And then all you would have to do is run a BLAST alignment
Hmmm good point, but I’m just curious if it’s a normal base pair mutation or a microindel if gel electrophoresis would allow you to detect such a minute change? I feel like just a single base pair mutation would be difficult to detect through a gel since the weight and length would be almost identical to the unmutated molecule. It definitely could be worth a shot and would definitely be a cheaper option than sequencing.
Also yes sadly a few hundred dollars for me is still kind of expensive. But I also imagine we’d want several spiders sequenced and several normals sequenced in order to reduce normal background noise and error which would bring the project total well into the thousands. I can’t seem to find any ball python samples on genbank that would directly help our project so we’d probably be starting from scratch at least trying to explore the bmp morphogens. I believe nucleotide diversity among synonymous sites in reptiles averages around 1% whereas in humans it’s around 0.1% or so, so we’d definitely want to check our bases (pun) as we go to avoid the larger error chance in reptiles.
Last edited by Natural; 02-22-2019 at 10:47 AM.
-
-
BPnet Veteran
Re: Spider Morph Head Wobble Hypothesis
The technology to locate the spider gene in the ball python genome is for sure already well developed. The problem is that such a project would cost over $10,000, and may end up significantly more expensive than that. $10,000 would just be the starting point. And we would need several samples to compare, etc. It would take time and money.
Taking it a step further and trying to determine whether a specific DNA change is leading to the wobble would be more complicated because the wobble seems to clearly be partly from genetics, and partly from environmental factors. I have hatched out and raised many spiders that don’t wobble at all, and others that were fine for years, then one day all of a sudden start to wobble. So I don’t think the wobble could be explained just by genetics, there must be some changes in gene expression going on as well. This could be due to epigenetic changes. But, don’t know for sure right now.
I had a friend in grad school that had done LOTS of chicken genetics work and he said what I described in spider ball pythons sounded just like something that is very well characterized in chickens and has to do with the alteration of the migration of neural crest cells in early embryonic development. Melanocytes travel with these neural crest cells and when their migration is altered, feather/scale color is altered as well.
Anyway, it would be fun to work on something like this eventually, but I don’t see how we would fund it right now.
Last edited by bhmorrill; 02-22-2019 at 10:22 PM.
-
The Following User Says Thank You to bhmorrill For This Useful Post:
-
Re: Spider Morph Head Wobble Hypothesis
This thread makes me feel wayyy too dumb. 
But I'm glad there are people here that are so smart about science!
-
The Following User Says Thank You to Treeman For This Useful Post:
-
Re: Spider Morph Head Wobble Hypothesis
 Originally Posted by Natural
Hmmm good point, but I’m just curious if it’s a normal base pair mutation or a microindel if gel electrophoresis would allow you to detect such a minute change? I feel like just a single base pair mutation would be difficult to detect through a gel since the weight and length would be almost identical to the unmutated molecule. It definitely could be worth a shot and would definitely be a cheaper option than sequencing.
A "micro"-type mutation or a SNP would not be able to be resolved on a gel, no. But we do not know one way or another what type of mutation we are dealing with, nor that this is necessarily even the correct gene to be interrogating. The PCR I was describing could act as a quick, cheap check: Why spend the $10K Ben notes above on a full genetic analysis when a $25 test could potentially answer the same question?? And even if the gel does not show a difference in band pattern that is where amplicon sequencing would come in. Incremental interrogation helps keep the budget under control 
 Originally Posted by Natural
Also yes sadly a few hundred dollars for me is still kind of expensive.
I was speaking in the relative sense and not specifically to your budget. Amplicon sequencing at a few hundred dollars is significantly cheaper than full genome sequencing.
 Originally Posted by Natural
But I also imagine we’d want several spiders sequenced and several normals sequenced in order to reduce normal background noise and error which would bring the project total well into the thousands. I can’t seem to find any ball python samples on genbank that would directly help our project so we’d probably be starting from scratch at least trying to explore the bmp morphogens. I believe nucleotide diversity among synonymous sites in reptiles averages around 1% whereas in humans it’s around 0.1% or so, so we’d definitely want to check our bases (pun) as we go to avoid the larger error chance in reptiles.
Depends on how you go about it. Do I amplicon sequence fifty WT and fifty Spiders, run alignments of each set of fifty and look for consensus? Or do I pool the DNA from fifty WT and the DNA from fifty Spiders and run only two amplicon preps for sequencing and allow the bioinformatics to pull the consensus out for me?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|