Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 729

1 members and 728 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 17

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spider Morph Head Wobble Hypothesis

    Quote Originally Posted by Natural View Post
    Even if we did PCR, we’d still have to get it sequenced since PCR would just create the necessary amount of DNA for sequencing but wouldn’t actually give us any information. Sequencing is what actually costs a lot, and without sequencing we’d have no idea where the mutation lies. Even then we’d need to sequence several normal and spider ball pythons in order to make better supported comparisons and be able to eliminate genetic background noise between the individuals.
    You would not necessarily have to get it sequenced. And indel in the gen would generate a product of a different length than the WT and this would resolve as a band with altered mobility on a gel. This is basically what they did for locating the mutation in Albino corn snakes:
    https://www.nature.com/articles/srep17118/figures/3

    And even if you did have to get the amplicon sequenced, no, sequencing does not cost a lot. Amplicon sequencing might cost you a couple hundred bucks. And then all you would have to do is run a BLAST alignment


    Quote Originally Posted by alittleFREE View Post
    Check out Rare Genetics Inc. They are doing a lot of work with snake DNA sequencing.
    This is not the kind of work Ben is doing. He could probably knock it together, but I am not sure the impetus would be there for him
    Last edited by mlededee; 02-27-2019 at 03:27 AM. Reason: Fixed link
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1