Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,708

2 members and 1,706 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,111
Threads: 249,260
Posts: 2,573,015
Top Poster: JLC (31,651)
Welcome to our newest member, MittieParris8
Results 1 to 10 of 18

Thread: MONARCH pics

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Nice animals Rance, cool to see how the project is continuing along.

    I remember that at some point you picked up an Ultramel to check on compatibility/allelism... Any results to report on that?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Lord Sorril (02-21-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1