» Site Navigation
1 members and 842 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,204
Threads: 248,615
Posts: 2,569,216
Top Poster: JLC (31,651)
|
-
Champagne can have some interesting pattern effects.
Cinny or black pastel + fire can also give you that look.
-
The Following User Says Thank You to bcr229 For This Useful Post:
-
Re: Pattern mutations?
SPARK!!! Not Specter. That was the one I was trying to remember.
-
The Following User Says Thank You to Lord Sorril For This Useful Post:
-
Re: Pattern mutations?
Originally Posted by bcr229
Champagne can have some interesting pattern effects.
Cinny or black pastel + fire can also give you that look.
I don’t think the sire is carrying either of those. He produced 27 babies last season with only one normal. No champagne, black pastel, or cinnamon popped up.
These guys should only have a few genes at play:
Pastel/Super Pastel
Fire
YB
And het Pied in the first pic
Why they are so orange is another question.....
-
-
You are just seeing the synergistic effect of combining Fire, Pastel, and YB. I have and have made numerous Firefly, Superfly, Bellyfly, Superbellyfly, etc and they all tend to have some level or other of that floating/warping/wiping on them
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Pattern mutations?
Originally Posted by asplundii
You are just seeing the synergistic effect of combining Fire, Pastel, and YB. I have and have made numerous Firefly, Superfly, Bellyfly, Superbellyfly, etc and they all tend to have some level or other of that floating/warping/wiping on them
Thanks for the input! Definitely appreciated.
Any of those you produced turning orange in the flames and/or blushing? These really don’t have flames, they are just orange between the pattern.
-
-
Re: Pattern mutations?
Originally Posted by asplundii
You are just seeing the synergistic effect of combining Fire, Pastel, and YB. I have and have made numerous Firefly, Superfly, Bellyfly, Superbellyfly, etc and they all tend to have some level or other of that floating/warping/wiping on them
Also the heads on these are all wrong for them to be superfly, at least from what I have seen. Everything I’ve seen the heads are almost completely white. Maybe the YB is darkening up the head??
-
-
-
-
Re: Pattern mutations?
Originally Posted by MS2
Any of those you produced turning orange in the flames and/or blushing? These really don’t have flames, they are just orange between the pattern.
Depends on your definition of "orange"... Nothing that is OD level "orange" but some have a slight umber undertone to them.
Originally Posted by MS2
Also the heads on these are all wrong for them to be superfly, at least from what I have seen. Everything I’ve seen the heads are almost completely white. Maybe the YB is darkening up the head??
This kind of depends on age and expression levels. I have had a few Superflies that had fairly pigmented heads and some that have been nearly "bald"-looking. And yes, YB can influence this
Originally Posted by MS2
Both are from the same clutch. I though Fire is a highlighter gene, not whacking out the pattern and turning orange. Combination of fire and yb??k
Fire does have a pattern distortion effect. If you look at single gene Fire animals you can see that their patterning is atypical. When combined with Pastel and YB, which are also both pattern impacting mutants, you get synergistic effects
Originally Posted by MS2
Here is my sire. What I believe to be a Firefly Yellowbelly
Looks like my Bellyfly breeder male so I would agree with that ID
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|