Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 672

1 members and 671 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,106
Posts: 2,572,115
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 2 FirstFirst 12
Results 11 to 14 of 14
  1. #11
    BPnet Senior Member MR Snakes's Avatar
    Join Date
    11-25-2018
    Location
    Rockbound coast of Maine, USA
    Posts
    2,667
    Thanks
    1,258
    Thanked 477 Times in 379 Posts

    Re: Escaping from bad marriage-- my story-- and please share yours too

    Quote Originally Posted by kevink View Post
    great to hear. My $0.02 is that you should stop counting your ex-anniversaries though, and reliving this stuff. If its over move on, just let go and start a new chapter. I think it will only help you. Cheers.
    this

  2. #12
    BPnet Veteran FollowTheSun's Avatar
    Join Date
    11-15-2018
    Posts
    674
    Thanks
    1,351
    Thanked 1,102 Times in 461 Posts

    Re: Escaping from bad marriage-- my story-- and please share yours too

    Quote Originally Posted by MR Snakes View Post
    this
    I think that's a good idea. I will celebrate this year, and just let it go. My partner is a recovering alcoholic and last year I had a special little celebration already two mark his second year sober, and he said he would rather just put that behind him and not think about it or celebrate.

    Sent from my SM-G960U1 using Tapatalk
    2 BP's, one ratsnake, 2 dogs, 3 cats, 2 small caged birds, 7 chickens, and a toddler in a pear tree

  3. The Following User Says Thank You to FollowTheSun For This Useful Post:

    Bogertophis (01-19-2019)

  4. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Escaping from bad marriage-- my story-- and please share yours too

    Quote Originally Posted by FollowTheSun View Post
    I would love to hear the stories of others who have left bad marriages.

    All the tell-tales of what was to come were there from the beginning, but like you, I was young. I was also stupid.

    Long story short, she had a substance abuse problem. When you are young and stupid you rationalize that someone who drinks and drugs is just "experiencing youth" and will eventually grow out of it. But after you move across the country and buy a house and put yourself through grad school and are the only person in the marriage working and have a kid and are doing most of the parenting and move again and get a real job and buy another house and realize that you are rapidly approaching 40 but are married to someone who is still acting/living like they are a freshman in college rebelling against the world you start to re-evaluate your life. She never acknowledged her substance abuse. More to the point, she tried to say that I was the cause of her drinking and drugging. And also her rampant cheating. She would use any slight transgression to start a fight, then escalate the fight, and then go and get wasted. I would say that for the last four years of the marriage she was never sober and I actually looked forward to the days where I would come home and find her passed out drunk just because it meant she could not scream at me. I finally hit my breaking point after she ran off for three months. I hired a divorce lawyer and told her I was done. She tried to force herself back into my life and I ended up having to get a restraining order against her (came home and found a loaded gun just sitting on the kitchen counter).

    It has been four years now and my life is significantly better. I no longer suffer chronic anxiety attacks, my kid no longer tears out her eyelashes/eyebrows and quit biting her fingernails off until they bled. I am remarried, living in a new city (same job, longer commute) and our blended family is so much more stable and happy than anything I have known before.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (01-19-2019),zina10 (01-15-2019)

  6. #14
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,789
    Thanks
    29,346
    Thanked 20,562 Times in 12,287 Posts

    Re: Escaping from bad marriage-- my story-- and please share yours too

    Quote Originally Posted by asplundii View Post
    ...
    It has been four years now and my life is significantly better. I no longer suffer chronic anxiety attacks, my kid no longer tears out her eyelashes/eyebrows and quit biting her fingernails off until they bled. I am remarried, living in a new city (same job, longer commute) and our blended family is so much more stable and happy than anything I have known before.
    So easy to make mistakes in relationships, & we've usually promised to try to make it work (whether by legal or other means), but really the best thing you
    can do when nothing works is to walk away & get on with a better life...both for you & your children. We cannot change our partners who don't want to change, &
    often not even if they WANT to change. Glad you made it out of the nightmare.

  7. The Following User Says Thank You to Bogertophis For This Useful Post:

    asplundii (01-22-2019)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1