» Site Navigation
0 members and 1,869 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,104
Threads: 249,252
Posts: 2,572,980
Top Poster: JLC (31,651)
|
-
Re: Escaping from bad marriage-- my story-- and please share yours too
 Originally Posted by kevink
great to hear. My $0.02 is that you should stop counting your ex-anniversaries though, and reliving this stuff. If its over move on, just let go and start a new chapter. I think it will only help you. Cheers.
this
-
-
Re: Escaping from bad marriage-- my story-- and please share yours too
 Originally Posted by MR Snakes
this
I think that's a good idea. I will celebrate this year, and just let it go. My partner is a recovering alcoholic and last year I had a special little celebration already two mark his second year sober, and he said he would rather just put that behind him and not think about it or celebrate.
Sent from my SM-G960U1 using Tapatalk
2 BP's, one ratsnake, 2 dogs, 3 cats, 2 small caged birds, 7 chickens, and a toddler in a pear tree
-
The Following User Says Thank You to FollowTheSun For This Useful Post:
-
Re: Escaping from bad marriage-- my story-- and please share yours too
 Originally Posted by FollowTheSun
I would love to hear the stories of others who have left bad marriages.
All the tell-tales of what was to come were there from the beginning, but like you, I was young. I was also stupid.
Long story short, she had a substance abuse problem. When you are young and stupid you rationalize that someone who drinks and drugs is just "experiencing youth" and will eventually grow out of it. But after you move across the country and buy a house and put yourself through grad school and are the only person in the marriage working and have a kid and are doing most of the parenting and move again and get a real job and buy another house and realize that you are rapidly approaching 40 but are married to someone who is still acting/living like they are a freshman in college rebelling against the world you start to re-evaluate your life. She never acknowledged her substance abuse. More to the point, she tried to say that I was the cause of her drinking and drugging. And also her rampant cheating. She would use any slight transgression to start a fight, then escalate the fight, and then go and get wasted. I would say that for the last four years of the marriage she was never sober and I actually looked forward to the days where I would come home and find her passed out drunk just because it meant she could not scream at me. I finally hit my breaking point after she ran off for three months. I hired a divorce lawyer and told her I was done. She tried to force herself back into my life and I ended up having to get a restraining order against her (came home and found a loaded gun just sitting on the kitchen counter).
It has been four years now and my life is significantly better. I no longer suffer chronic anxiety attacks, my kid no longer tears out her eyelashes/eyebrows and quit biting her fingernails off until they bled. I am remarried, living in a new city (same job, longer commute) and our blended family is so much more stable and happy than anything I have known before.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (01-19-2019),zina10 (01-15-2019)
-
Re: Escaping from bad marriage-- my story-- and please share yours too
 Originally Posted by asplundii
...
It has been four years now and my life is significantly better. I no longer suffer chronic anxiety attacks, my kid no longer tears out her eyelashes/eyebrows and quit biting her fingernails off until they bled. I am remarried, living in a new city (same job, longer commute) and our blended family is so much more stable and happy than anything I have known before.
So easy to make mistakes in relationships, & we've usually promised to try to make it work (whether by legal or other means), but really the best thing you
can do when nothing works is to walk away & get on with a better life...both for you & your children. We cannot change our partners who don't want to change, &
often not even if they WANT to change. Glad you made it out of the nightmare.
-
The Following User Says Thank You to Bogertophis For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|