Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,103

0 members and 2,103 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,086
Threads: 249,227
Posts: 2,572,841
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
Results 1 to 5 of 5
  1. #1
    Registered User Taying's Avatar
    Join Date
    12-29-2018
    Location
    Illinois, USA
    Posts
    31
    Thanks
    36
    Thanked 26 Times in 12 Posts
    Images: 2

    VPI Axanthic x Mojave morph, adult expectations

    I have read that axanthics tend to brown out as they age, though some strains are more likely to keep their black and white coloration. I have a 5.5 month old VPI Axanthic Mojave morph with beautiful silver and black coloration. I'm not finding much information on a Mojave-axanthic morph but am wondering if anyone has information about their coloration as adults. I’ve read that VPI axanthics are sometimes known to not brown out but am wondering if the addition of Mojave will make him more likely to brown out. Also when does browning out usually occur in axanthics? In the grand scheme, i know it's relatively unimportant what color he is but I am curious as to what to expect. He will be loved regardless. ��
    Last edited by Taying; 12-30-2018 at 06:11 PM.

  2. #2
    BPnet Senior Member MR Snakes's Avatar
    Join Date
    11-25-2018
    Location
    Rockbound coast of Maine, USA
    Posts
    2,667
    Thanks
    1,258
    Thanked 477 Times in 379 Posts
    Don't know if anyone has said it but welcome....and Happy New Year!

  3. The Following User Says Thank You to MR Snakes For This Useful Post:

    Taying (01-01-2019)

  4. #3
    Registered User Taying's Avatar
    Join Date
    12-29-2018
    Location
    Illinois, USA
    Posts
    31
    Thanks
    36
    Thanked 26 Times in 12 Posts
    Images: 2

    Re: VPI Axanthic x Mojave morph, adult expectations

    Quote Originally Posted by MR Snakes View Post
    Don't know if anyone has said it but welcome....and Happy New Year!
    Thank you! Happy new year to you!

  5. The Following User Says Thank You to Taying For This Useful Post:

    MR Snakes (01-01-2019)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Quote Originally Posted by Taying View Post
    I have read that axanthics tend to brown out as they age, though some strains are more likely to keep their black and white coloration.
    Quote Originally Posted by Taying View Post
    I’ve read that VPI axanthics are sometimes known to not brown out
    VPI was often touted as being "better" at not browning out but truth of the matter is that there is no one line of Axanthic that is more likely to keep its colouration. That said, there are some people who have worked heavily with selectively breeding some Axanthic lines that have adults that maintain their colour to a much higher degree. JD Constrictors is an excellent example of this, he works with TSK line Axanthics


    Quote Originally Posted by Taying View Post
    I'm not finding much information on a Mojave-axanthic morph but am wondering if anyone has information about their coloration as adults.
    I do not know about Axanthic Mojaves specifically but I am inclined to believe that the combo will hold the Axanthic colouring a bit better than a non-Mojave would. See below for the "why"


    Quote Originally Posted by Taying View Post
    Also when does browning out usually occur in axanthics?
    Typically you are going to start seeing it around the time your animal goes through its ontogenetic colour change (yes, balls do have an ontogenetic colour change). Usually this happens at around the time the animal hits 500-700g but it can hit sooner.



    Something to understand about Axanthic morphs... They are not actually axanthic and are probably better viewed as hypoxanthic. Nick Mutton gives a pretty decent explanation during the Genetic Round Table episode of MPR a couple months back (I would link it but the firewall here will not let me go to BlogTalkRadio, should be easy to google it though)

    This is a bit of an unpopular opinion in many circles but there is sound reasoning behind it and it especially makes sense when you consider the browning out factor. When these animals go through their ontogenetic change, the rate of/level of expression and the deposition of pigments changes. So when the "adult" pigmentation process starts you will begin to see the browning out as melanin and xanthin pigments interact.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    Taying (01-03-2019)

  8. #5
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts

    Re: VPI Axanthic x Mojave morph, adult expectations

    My favorite line is the TSK.


    Sent from my iPhone using Tapatalk

  9. The Following User Says Thank You to Godzilla78 For This Useful Post:

    Taying (01-03-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1