Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,818

2 members and 1,816 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,086
Threads: 249,227
Posts: 2,572,841
Top Poster: JLC (31,651)
Welcome to our newest member, diingoo
Results 1 to 6 of 6
  1. #1
    New Member
    Join Date
    11-25-2018
    Location
    Italy
    Posts
    4
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Albino, lavender and caramel differences

    Hi all, I'm new here and starting with a noobie question.
    I am studying about albinos, and i can't figure out with precision the characteristics of, and differences between normal albino, lavender albino and caramel albino.
    I know that caramel is t+ and other 2 are t-, and they should be on 3 different loci.
    Anyone that can give me more info?

    Thank you

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino, lavender and caramel differences

    Quote Originally Posted by Pigiama View Post
    I am studying about albinos, and i can't figure out with precision the characteristics of, and differences between normal albino, lavender albino and caramel albino.
    I know that caramel is t+ and other 2 are t-, and they should be on 3 different loci.
    Actually, the classic Albino is T- (at least that is the assumption, it may not be true but without sequence data we cannot know for sure) and Lav and Caramel are both T+

    You are correct that they are three different loci

    Albinos basically show no expression of melanin so the only pigment we see is the yellows. Lav and Caramel have reduced levels of melanin expression, perhaps 15% and 40% respectively (and arbitrarily) which leads to the "purple" hue in Lavs and the golden/honey hue in Caramels.

    Albinos are allelic to Candy/Toffee.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    TopNotchPythons (08-31-2019)

  4. #3
    New Member
    Join Date
    11-25-2018
    Location
    Italy
    Posts
    4
    Thanks
    0
    Thanked 0 Times in 0 Posts
    ok great. thank you.

    Moreover: being them different loci, if i bred a caramel x lavander i should obtain all hets for both. But what if i bred theese hets with other hets? is there a "super form" that is recessive for both?

  5. #4
    Registered User
    Join Date
    11-10-2018
    Location
    DFW, TX
    Posts
    113
    Thanks
    19
    Thanked 108 Times in 58 Posts
    Images: 4
    I believe there is a way for you to get a double recessive albino, but I don't think they'll look any different than a regular albino as the regular albino will pull the amount the melanin out of the animal. So lavender or carmel albino won't show through, but it would produce visual offspring when paired with either a regular or the secondary albino type it contains.

    As far as I know the types of recessives that show with albino are pied, clown, genetic stripe, and possibly axanthic. But I'm not positive on how they all look besides albino pied's.

  6. #5
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Albino, lavender and caramel differences

    Quote Originally Posted by asplundii View Post
    Actually, the classic Albino is T- (at least that is the assumption, it may not be true but without sequence data we cannot know for sure) and Lav and Caramel are both T+
    .
    Double emphasize the word "assumption" there. The classic test for albino is the dopa test, and as far as I know, nobody has done that or any other such test on any boa or python. H. B. Bechtel did dopa tests on the corn snake and a few other colubrids. Recently the amelanistic mutant in the corn snake, which Bechtel labelled as T-, has been sequenced. That mutant is actually OCA2 negative rather than T-. See https://www.nature.com/articles/srep17118

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino, lavender and caramel differences

    Quote Originally Posted by Pigiama View Post
    Moreover: being them different loci, if i bred a caramel x lavander i should obtain all hets for both. But what if i bred theese hets with other hets? is there a "super form" that is recessive for both?
    Yes, breeding Lav x Caramel would yield offspring that are WT in appearance but double het genetically (i.e., het Lav and het Caramel). If you breed a pair of double hets together you have a 1/16 chance of a double visual Caramel Lav. To the best of my knowledge no one has done this but your outcome would be an animal that looked like an extremely faded Lav. A good example that has been done however, is the Caramel Ultramel double visual called the Camarillo.

    And, as RXL mentioned, any double visual of classic Albino with one of the other albino-types morphs (e.g., Albino Caramel, Albino Lav, Albino Banana, etc.,) will look like an Albino


    Quote Originally Posted by paulh View Post
    Double emphasize the word "assumption" there... Recently the amelanistic mutant in the corn snake, which Bechtel labelled as T-, has been sequenced. That mutant is actually OCA2 negative rather than T-. See https://www.nature.com/articles/srep17118
    Yes, that paper is one of the reasons I note the assumption factor. Also the Sharpe and Kahl boa morphs appear T- but are incompatible so at least one of them must be T+. And we see the same thing with retics and burms. I have also seen a couple convincing arguments that the Albino in hognose is a T+ type.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    dr del (12-16-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1