Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 701

0 members and 701 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,103
Posts: 2,572,095
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 20

Threaded View

  1. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Butter Enchi OD Pastel YB x male1 (128 possible combos)
    Hypo Lesser/Mojave x male1 (8 or 16 possible combos [depending on if male is het Hypo])
    RedStripe x male1 (8 possible combos)
    Albino Woma x male1 (8 possible combos)

    Mojave x GStripe RedStripe (4 possible combos)
    RedStripe het GStripe x GStripe RedStripe (6 possible combos)
    Female 1 x GStripe RedStripe (4 possible combos)

    Mojave het Albino x male2 (8 possible combos)

    OD Pastel YB x male3 (24 possible combos)

    Albino Pin x male4 (8 possible combos)
    WT x male4 (4 possible combos))

    Dinker female x Banana "het Dinker"
    Dinker female x "het Dinker"

    "het Dinker" female x Banana "het Dinker"
    "het Dinker" female x "het Dinker"
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    PghBall (11-15-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1