Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,231

0 members and 1,231 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,142
Posts: 2,572,362
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 10
  1. #1
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Possible Cue ball neurologic issues?

    Im wondering if my gal has some issues possibly related to her morph or maybe she's just a little "special" with no relation. The best I can describe would be similar to a spider that gets excited during feeding and shows its wobble, but she doesn't wobble, just has terrible aim and ends up striking way off a few times before she grabs her rat off the tongs. Im not sure if this is new for her or I've just noticed it more over the last few feedings since she's gained a few hundred grams. Im aware of the usual related kinking/duck bill birth defects but haven't heard of anything similar to this. Maybe she's just a little over excited to strike but I cant think of any of my other snakes having such poor aim consistently. I'll try to get a video next time. Besides that she never shows any other odd behavior or things to make me concerned about her health. I know its not odd for snakes to miss occassionally but I feel so bad when she hits the side of her tub.

    Sent from my SM-G920T using Tapatalk

  2. #2
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,834
    Thanks
    29,467
    Thanked 20,611 Times in 12,319 Posts
    Just poor vision would be my guess? Have you tried feeding her in dim light versus bright light? Bright light might be hurting her eyes?

  3. The Following User Says Thank You to Bogertophis For This Useful Post:

    JodanOrNoDan (08-15-2018)

  4. #3
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Possible Cue ball neurologic issues?

    Quote Originally Posted by Bogertophis View Post
    Just poor vision would be my guess? Have you tried feeding her in dim light versus bright light? Bright light might be hurting her eyes?
    I feed at night in pretty dim lighting. Ive thought the albino aspect could be part of it but they should be using mostly scent and heat to strike at plus my other albino morphs have never done this.

    Sent from my SM-G920T using Tapatalk

  5. #4
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,834
    Thanks
    29,467
    Thanked 20,611 Times in 12,319 Posts

    Re: Possible Cue ball neurologic issues?

    Quote Originally Posted by Hannahshissyfix View Post
    I feed at night in pretty dim lighting. Ive thought the albino aspect could be part of it but they should be using mostly scent and heat to strike at plus my other albino morphs have never done this.

    Sent from my SM-G920T using Tapatalk
    Yes, I agree. Maybe other owners will have more input on this?

  6. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    There are no issues with Albinos and the "poor vision" thing is an old wives tale that needs to die.

    Slight neuro issue has been documented in SuperBlack/SuperCinny. May or may not be the case here, I would suggest keeping an eye on her and seeing if the behaviour is temporary or sustained. Even if it is sustained it may not be a neuro tic, I have a couple animals that intentionally bluff strike a few times before actually making their "kill" strike. So long as the animal is eating and otherwise healthy I would not stress it
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #6
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Possible Cue ball neurologic issues?

    For what it's worth , 7 out of my 14 snakes are Albino and they all seem to have poorer eyesight compared to the others ...


    To be fair I'm not sure it is an old wives tale .... I'm sure I've read things in the past about Albinos having dodgy or at least very sensitive eyesight .... don't even Albino humans have issues ??



    Sent from my iPhone using Tapatalk




  8. The Following 2 Users Say Thank You to Zincubus For This Useful Post:

    Bogertophis (08-15-2018),JodanOrNoDan (08-15-2018)

  9. #7
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Possible Cue ball neurologic issues?

    Edit

    Individuals with albinism do not have clear vision due to an underdevelopment of the central part of the retina called the macula. The macula is responsible for sharp, detail vision which works most well in bright light. The retina is very pale because of the lack of pigment.


    Sent from my iPhone using Tapatalk




  10. The Following User Says Thank You to Zincubus For This Useful Post:

    Hannahshissyfix (08-16-2018)

  11. #8
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77
    Yeah, I have a few normal albinos and some lavenders. The normal ones have noticeable vision issues. The lavenders seem to see a little better. I don't know why. Albino plus spider makes for some interesting feeding gymnastics.
    Honest, I only need one more ...

  12. The Following User Says Thank You to JodanOrNoDan For This Useful Post:

    Bogertophis (08-15-2018)

  13. #9
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,834
    Thanks
    29,467
    Thanked 20,611 Times in 12,319 Posts
    Like others already noted, the albinos I've kept in the past had noticeably poorer vision than other snakes I've kept. Also, when some of my snakes (of normal
    coloration) became geriatric, their vision also seems to suffer from when they were younger. My 19-year old corn snake is a good example...he has a good
    appetite but grabbing his f/t mouse is much more of a challenge than it used to be.

  14. The Following User Says Thank You to Bogertophis For This Useful Post:

    JodanOrNoDan (08-15-2018)

  15. #10
    BPnet Senior Member Hannahshissyfix's Avatar
    Join Date
    07-14-2015
    Posts
    1,283
    Thanks
    598
    Thanked 1,390 Times in 619 Posts

    Re: Possible Cue ball neurologic issues?

    Quote Originally Posted by asplundii View Post
    There are no issues with Albinos and the "poor vision" thing is an old wives tale that needs to die.

    Slight neuro issue has been documented in SuperBlack/SuperCinny. May or may not be the case here, I would suggest keeping an eye on her and seeing if the behaviour is temporary or sustained. Even if it is sustained it may not be a neuro tic, I have a couple animals that intentionally bluff strike a few times before actually making their "kill" strike. So long as the animal is eating and otherwise healthy I would not stress it
    Do you have sources for your claim that albinos do not have poorer vision? Im aware that it wont make much of a difference for my situation but as others mentioned, that goes against my reading of how albinism effects every other kind of animal down to my friends albino son who has extreme vision issues from his near purple eyes.

    Sent from my SM-G920T using Tapatalk

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1