» Site Navigation
0 members and 1,960 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,705
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..
Sorry if this is not the correct place for this, I am very new to the community. Long time viewer, first time poster.
TL:DR: My ball python has little black dots down his spine for about an inch under his head, for about an inch. I left a link to photos below.
My little guy here is around 4 months old or so, a Super Mojave, and has developed these greyish spots directly over his spine which, when viewed closer, appear to be black and in between or under the scales; not the scales themselves. They appeared around 4 to 5 days ago or so, at least that I've noticed, and are around an inch from his head. They only take place here for about an inch. He has no signs of scale-rot anywhere on his body, his habitat is very clean, decent humidity and temperature, and his belly is completely normal. He has not acted any different nor has refused food whatsoever. I'm probably just overreacting but I really love him and want to be sure if anything is wrong at all. He'll probably shed in around 2 weeks or so, give or take, and I plan to bring him to my local reptile specialist store to ask if they might know anything, this Thursday. If I don't figure out anything else I might take him to a vet.
Hopefully its nothing, but I worry. Thank you all in advance for any help you can give. :) I have attached an Imgur link to photos below as I can not yet post photos yet due to my account being new.
https://imgur.com/gallery/KKvcIsR
-
-
Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..
 Originally Posted by squeekstir
Sorry if this is not the correct place for this, I am very new to the community. Long time viewer, first time poster.
TL  R: My ball python has little black dots down his spine for about an inch under his head, for about an inch. I left a link to photos below.
My little guy here is around 4 months old or so, a Super Mojave, and has developed these greyish spots directly over his spine which, when viewed closer, appear to be black and in between or under the scales; not the scales themselves. They appeared around 4 to 5 days ago or so, at least that I've noticed, and are around an inch from his head. They only take place here for about an inch. He has no signs of scale-rot anywhere on his body, his habitat is very clean, decent humidity and temperature, and his belly is completely normal. He has not acted any different nor has refused food whatsoever. I'm probably just overreacting but I really love him and want to be sure if anything is wrong at all. He'll probably shed in around 2 weeks or so, give or take, and I plan to bring him to my local reptile specialist store to ask if they might know anything, this Thursday. If I don't figure out anything else I might take him to a vet.
Hopefully its nothing, but I worry. Thank you all in advance for any help you can give.  I have attached an Imgur link to photos below as I can not yet post photos yet due to my account being new.
https://imgur.com/gallery/KKvcIsR
That disgusting 'idiot' who left that disgraceful comment and GIF should be reported and banned !
It looks as though YOU will have to report them though ... I'd also put them on IGNORE or whatever ..
Sent from my iPhone using Tapatalk
-
-
I cannot view the image (imgur is blocked here) but given your animal is a SuperMojave it is possible that what you are seeing is some of the pigmentation that SuperMojaves develop with age.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..
 Originally Posted by asplundii
I cannot view the image (imgur is blocked here) but given your animal is a SuperMojave it is possible that what you are seeing is some of the pigmentation that SuperMojaves develop with age.
I just made a new URL of the photos:
https://tinyurl.com/yapjco98
-
-
Registered User
Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..
 Originally Posted by Zincubus
That disgusting 'idiot' who left that disgraceful comment and GIF should be reported and banned !
It looks as though YOU will have to report them though ... I'd also put them on IGNORE or whatever ..
Sent from my iPhone using Tapatalk
I'm confused, I don't see any other reply to this thread other than someone asking of the pigmentation of the BP. Who left a disgraceful comment?
-
-
Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..
..The aptly named 8UTTHO1E....
They left you a disgusting comment in your IMGUR link .. I had a go at him/her / it ..
When you get a moment you should report their comment and gif post or they will keep doing it .
Sent from my iPhone using Tapatalk
Last edited by Zincubus; 08-15-2018 at 09:29 AM.
-
-
I have more than a couple white snakes. The coloration changes during shed cycles, time of year and age. Dark blotches come and go. I don't see anything bad and it will probably go away next shed. It could just be dirt. Some ball pythons love to play with their poop. Especially the white ones. LOL. Because the snake is white you will see every skin change, dirt spot, etc. All these things happen with other balls, we just can't see them because it is hidden by the snake's coloration.
Honest, I only need one more ...
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
asplundii (08-16-2018),Bogertophis (08-15-2018)
-
Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..
 Originally Posted by Zincubus
..The aptly named 8UTTHO1E....
They left you a disgusting comment in your IMGUR link .. I had a go at him/her / it ..
When you get a moment you should report their comment and gif post or they will keep doing it .
Sent from my iPhone using Tapatalk
Let's make this clear whatever happens somewhere else can stay somewhere else and does not need to be mentioned here or brought here nor do we need you to encourage our members to gang up on someone on another platform, in essence we do not need YOU to bring third party drama here, if you want to get involve in the drama do so over there. This is not debatable and any further mention will be deleted
Last edited by Stewart_Reptiles; 08-15-2018 at 01:32 PM.
-
-
OP there is nothing abnormal about your snake that I can see, it boils down to the fact that keeping a white snake white is almost impossible, between substrate staining their scales, to poop etc, your snake will not remain white but there is nothing that appears unhealthy.
-
-
Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..
 Originally Posted by Deborah
OP there is nothing abnormal about your snake that I can see, it boils down to the fact that keeping a white snake white is almost impossible, between substrate staining their scales, to poop etc, your snake will not remain white but there is nothing that appears unhealthy.
I wonder if I could sneak in with a black sharpie and draw hieroglyphs on the BEL would OP think aliens visited?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|