Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,954

2 members and 1,952 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,705
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Results 1 to 10 of 10
  1. #1
    Registered User
    Join Date
    08-14-2018
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Unhappy Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..

    Sorry if this is not the correct place for this, I am very new to the community. Long time viewer, first time poster.

    TL:DR: My ball python has little black dots down his spine for about an inch under his head, for about an inch. I left a link to photos below.

    My little guy here is around 4 months old or so, a Super Mojave, and has developed these greyish spots directly over his spine which, when viewed closer, appear to be black and in between or under the scales; not the scales themselves. They appeared around 4 to 5 days ago or so, at least that I've noticed, and are around an inch from his head. They only take place here for about an inch. He has no signs of scale-rot anywhere on his body, his habitat is very clean, decent humidity and temperature, and his belly is completely normal. He has not acted any different nor has refused food whatsoever. I'm probably just overreacting but I really love him and want to be sure if anything is wrong at all. He'll probably shed in around 2 weeks or so, give or take, and I plan to bring him to my local reptile specialist store to ask if they might know anything, this Thursday. If I don't figure out anything else I might take him to a vet.

    Hopefully its nothing, but I worry. Thank you all in advance for any help you can give. :) I have attached an Imgur link to photos below as I can not yet post photos yet due to my account being new.

    https://imgur.com/gallery/KKvcIsR

  2. #2
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,009
    Thanks
    2,526
    Thanked 4,966 Times in 3,028 Posts

    Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..

    Quote Originally Posted by squeekstir View Post
    Sorry if this is not the correct place for this, I am very new to the community. Long time viewer, first time poster.

    TLR: My ball python has little black dots down his spine for about an inch under his head, for about an inch. I left a link to photos below.

    My little guy here is around 4 months old or so, a Super Mojave, and has developed these greyish spots directly over his spine which, when viewed closer, appear to be black and in between or under the scales; not the scales themselves. They appeared around 4 to 5 days ago or so, at least that I've noticed, and are around an inch from his head. They only take place here for about an inch. He has no signs of scale-rot anywhere on his body, his habitat is very clean, decent humidity and temperature, and his belly is completely normal. He has not acted any different nor has refused food whatsoever. I'm probably just overreacting but I really love him and want to be sure if anything is wrong at all. He'll probably shed in around 2 weeks or so, give or take, and I plan to bring him to my local reptile specialist store to ask if they might know anything, this Thursday. If I don't figure out anything else I might take him to a vet.

    Hopefully its nothing, but I worry. Thank you all in advance for any help you can give. I have attached an Imgur link to photos below as I can not yet post photos yet due to my account being new.

    https://imgur.com/gallery/KKvcIsR
    That disgusting 'idiot' who left that disgraceful comment and GIF should be reported and banned !

    It looks as though YOU will have to report them though ... I'd also put them on IGNORE or whatever ..


    Sent from my iPhone using Tapatalk




  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I cannot view the image (imgur is blocked here) but given your animal is a SuperMojave it is possible that what you are seeing is some of the pigmentation that SuperMojaves develop with age.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (08-15-2018)

  5. #4
    Registered User
    Join Date
    08-14-2018
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..

    Quote Originally Posted by asplundii View Post
    I cannot view the image (imgur is blocked here) but given your animal is a SuperMojave it is possible that what you are seeing is some of the pigmentation that SuperMojaves develop with age.
    I just made a new URL of the photos:

    https://tinyurl.com/yapjco98

  6. #5
    Registered User
    Join Date
    08-14-2018
    Posts
    3
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..

    Quote Originally Posted by Zincubus View Post
    That disgusting 'idiot' who left that disgraceful comment and GIF should be reported and banned !

    It looks as though YOU will have to report them though ... I'd also put them on IGNORE or whatever ..


    Sent from my iPhone using Tapatalk
    I'm confused, I don't see any other reply to this thread other than someone asking of the pigmentation of the BP. Who left a disgraceful comment?

  7. #6
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,009
    Thanks
    2,526
    Thanked 4,966 Times in 3,028 Posts

    Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..

    ..The aptly named 8UTTHO1E....
    They left you a disgusting comment in your IMGUR link .. I had a go at him/her / it ..


    When you get a moment you should report their comment and gif post or they will keep doing it .

    Sent from my iPhone using Tapatalk
    Last edited by Zincubus; 08-15-2018 at 09:29 AM.




  8. #7
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77
    I have more than a couple white snakes. The coloration changes during shed cycles, time of year and age. Dark blotches come and go. I don't see anything bad and it will probably go away next shed. It could just be dirt. Some ball pythons love to play with their poop. Especially the white ones. LOL. Because the snake is white you will see every skin change, dirt spot, etc. All these things happen with other balls, we just can't see them because it is hidden by the snake's coloration.
    Honest, I only need one more ...

  9. The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:

    asplundii (08-16-2018),Bogertophis (08-15-2018)

  10. #8
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..

    Quote Originally Posted by Zincubus View Post
    ..The aptly named 8UTTHO1E....
    They left you a disgusting comment in your IMGUR link .. I had a go at him/her / it ..


    When you get a moment you should report their comment and gif post or they will keep doing it .

    Sent from my iPhone using Tapatalk
    Let's make this clear whatever happens somewhere else can stay somewhere else and does not need to be mentioned here or brought here nor do we need you to encourage our members to gang up on someone on another platform, in essence we do not need YOU to bring third party drama here, if you want to get involve in the drama do so over there. This is not debatable and any further mention will be deleted
    Last edited by Stewart_Reptiles; 08-15-2018 at 01:32 PM.
    Deborah Stewart


  11. #9
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    OP there is nothing abnormal about your snake that I can see, it boils down to the fact that keeping a white snake white is almost impossible, between substrate staining their scales, to poop etc, your snake will not remain white but there is nothing that appears unhealthy.
    Deborah Stewart


  12. #10
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Blackish spots on my Blue Eyed Lucy BP? Kind of scared, and in need of help..

    Quote Originally Posted by Deborah View Post
    OP there is nothing abnormal about your snake that I can see, it boils down to the fact that keeping a white snake white is almost impossible, between substrate staining their scales, to poop etc, your snake will not remain white but there is nothing that appears unhealthy.
    I wonder if I could sneak in with a black sharpie and draw hieroglyphs on the BEL would OP think aliens visited?

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1