Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 634

0 members and 634 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,135
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 18

Threaded View

  1. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    A question for all the people that have made the argument of "snakes eat rodents in captivity so that is all you should feed them."

    Do you honestly feel that this is the best thing to do for species that have evolved to eat non-rodent? Especially with all of the very experienced breeders that are reporting high rates of things like obesity, fatty liver disease, metabolic failure, poor clutching, generally shorter life-spans, etc., in species like this when fed on exclusively rodent diets?

    If you really, truly believe in doing what is best for your animal then would it not be best to feed them what most closely resembles their evolved diet, be that something simple like supplementing with the occasional non-rodent item to something more complicated like going with an entirely non-rodent diet?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (08-13-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1