Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 757

0 members and 757 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,903
Threads: 249,098
Posts: 2,572,070
Top Poster: JLC (31,651)
Welcome to our newest member, wkeith67
Results 1 to 10 of 10

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I took in my sister's when she had to move to a place that would not allow snakes. It is very easy all in all. they like it a bit cooler so I just keep her at the ambient room temp (78-82) with no hot spot and she is fine. Eats great, sheds great, really mellow in temperament.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    kath_ (08-07-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1