» Site Navigation
0 members and 565 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Re: White Snakes
 Originally Posted by Turbo Serpent
I understand, but I would love to see a genetic comparison between them, although they are allelic, maybe the strongest of them all would actually be the alleles that provide the non white supers. But again its all speculation until we could breakdown each morph to basic levels to look.
I was not using a literal definition of strongest which is why I put quotation marks around it and defined the meaning I was using... It is not speculation to see the exact trend I pointed out. If I put a Mojave, a WT, a Lesser, and a Phantom in your hands and asked you put them in order of most to least different you would come up with Lesser : Mojave : Phantom : WT. Likewise, if I put a SuperMojave, a WT, a SuperLesser, and a SuperPhantom in your hands and asked you put them in order of most to least different you would come up with SuperLesser:SuperMojave:SuperPhantom:WT. The actual mechanism of the genetics behind it are moot, it is simply the phenotypic expression we are dealing with.
 Originally Posted by JodanOrNoDan
Not only that, but it seems to be also influenced by the time of year and where they are in the shed cycle.
Shed cycle certainly makes a difference. My Ivory gets dirtier-looking as he gets closer to shed. My SuperFire, on the other hand, gets more and more red/pink flushed as she approaches shed (I have a great pic of them side-by-side... I really need to find a new/better hosting site)
 Originally Posted by JodanOrNoDan
Mojave complex BEL's hatch out light pink. I am not sure about YB or fire.
My SuperFires had a pinkish flush to them when they hatched. My Passions, by contrast, had a more grey/blue tone to them.
 Originally Posted by JodanOrNoDan
In any case, I should have enough white animals of various ages and gene combos to have a little fun with. My original "operation" was designed to make RELs in as many combos as possible. Off of the top of my head, I think I have six clutches this year that will contain white snakes.
Depending on what you produce I may need to talk to you about adding some things to my collection... There area a couple of the Albino hetBluELs that I have been considering.
 Originally Posted by Ax01
imma just leave these two here:
Interesting pic. Perhaps it is an artifact of the photo itself or my computer screen but that CherryBomb seems to have a slight yellow tone to it compared to the other animal (PiedLesser I am guessing based on the microphthalmia???)
Last edited by asplundii; 07-25-2018 at 09:38 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (07-25-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|