Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

> FAQ

» Online Users: 585

0 members and 585 guests

No Members online

Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

None

Members: 75,909
Threads: 249,108
Posts: 2,572,135
Top Poster: JLC (31,651)

Welcome to our newest member, KoreyBuchanan

Results 1 to 10 of 37

07-24-2018, 08:39 AM #32
asplundii

View Profile

View Forum Posts

View Blog Entries

View Gallery Uploads
BPnet Veteran

Join Date

10-17-2008

Posts

906

Thanks

103

Thanked 722 Times in 382 Posts
Re: So what where mom and dad?

Originally Posted by JodanOrNoDan

The phantom pin pictured here is the grandfather to the current clutch. Granted an adult, but almost no dark line above the yellow eye line. I have some known phantom pins pipping now. Should have some something to compare to of similar age. I should have kept more pictures of older clutches.

Yeah, the darker line on my breeder girl is faint but it is there. However it is very distinctly there on both of my hatchlings.

Originally Posted by JodanOrNoDan

I should have kept more pictures of older clutches.

Story of my life LOL

actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Reply With Quote
The Following User Says Thank You to asplundii For This Useful Post:

JodanOrNoDan (07-24-2018)