Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,172

1 members and 1,171 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,143
Posts: 2,572,365
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 25

Thread: White Snakes

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: White Snakes

    Quote Originally Posted by Zincubus View Post
    I wonder if there's an accepted combo that gives the best WHITES ??
    All-white BlkEL and/or all-white Pied combo.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Zincubus (07-23-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1