Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 739

1 members and 738 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,139
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 10 of 16

Thread: Rhamphiophis

Threaded View

  1. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Rhamphiophis

    Quote Originally Posted by John1982 View Post
    Thanks for the info, Asplundii.
    No worries. Nice to see other people working with them


    Quote Originally Posted by rottn View Post
    Are they nocturnal? Is that why they have such big eyes? Just curious.
    Quote Originally Posted by John1982 View Post
    I would guess they're just a more sight oriented species.
    John is correct, they are extremely sight-oriented. Like the N. American coachwhip they cruise around with their heads held up, constantly looking around. As soon as they notice I am in the snake room they come to the front of their tubs and watch everything I do. This trait is also how I get them to sit still in the light tent for pics. While I stand ready with the camera I have my kid put her hands on either side of the tent and twitch a finger every now and then. The snake will freeze for a moment and tongue to figure out what it saw moving and that is when I capture the shot. Works for them now while they are smaller but I have a feeling that when they are 1.5m long it will the trick will not be as effective
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Charis (07-10-2018),John1982 (07-10-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1