Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,666

0 members and 1,666 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,934
Threads: 249,129
Posts: 2,572,283
Top Poster: JLC (31,651)
Welcome to our newest member, LavadaCanc
Results 1 to 5 of 5

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Feeding schedule for neonate ball pythons and such?

    Quote Originally Posted by SilverSerpentExotics View Post
    Thanks for the hopper tip. How many months are we talking before force feeding, 2 or 3? Before I should start to be concerned.
    Depends on the individual animal really. If it seems to be holding weight and not declining then I am less likely to force feed. If it is looking poor and losing weight rapidly then I try an assist feed to get it going.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    GalaxyMom (10-06-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1