Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 901

1 members and 900 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,928
Threads: 249,128
Posts: 2,572,274
Top Poster: JLC (31,651)
Welcome to our newest member, arushing027
Results 1 to 5 of 5

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Would be easier with post-shed individual pics in better light but I am inclined to say you have a Phantom, a Banana Phantom, 2 Banana Mojave, and a Banana BlkPastel Mojave.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (07-09-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1