» Site Navigation
2 members and 2,108 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.
» Today's Birthdays
» Stats
Members: 75,895
Threads: 249,089
Posts: 2,572,053
Top Poster: JLC (31,651)
|
-
Registered User
Radiant heat panel and Thermestat
Hi there, first time poster here!
So we have had a BP for that came with a 10gal starter glass tank. I have been maintaining it well, but obviously he needs more room. Me and the kids are planning to build a larger wood enclosure from pallet wood. I have been researching RHP and concluded that a 80 watt would serve a 40×18×12 or so enclosure. I just need some guidance on what are good brands for the panel and thermestat. I always see reptile basics for the panel but not so much chatter for the thermostat. TIA
-
-
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Radiant heat panel and Thermestat
Thermostat hands down would be a Herpstat. They can be pricey, but theyve pretty much become the standard in reptile keeping. One of the best thermostats ive ever used for sure.
Sent from my SM-G960U using Tapatalk
*****
The more silent you become, the more you are able to hear...
1.0 Super Cinny Banana Het Ghost BP - "Churro"
1.0 Mack Snow Leopard Gecko
0.1 Normal Leopard Gecko
-
-
Re: Radiant heat panel and Thermestat
I am interested in this too. What brand of RHP do you guys suggest?
Sent from my iPad using Tapatalk
0.1 Normal ball python Astrid
1.0 banana bumblebee Samwise
1.0 San Mattais rosy boa Charlie
1.0 bearded dragon Gimli
1.0 crested gecko Mr. Lizard
-
-
Re: Radiant heat panel and Thermestat
www.pro-products.com pro-heat RHP all the way. Pricier than Reptile basics but have a 10 year warranty
Sent from my iPhone using Tapatalk
-
The Following 2 Users Say Thank You to jmcrook For This Useful Post:
BR8080 (07-08-2018),MissterDog (07-06-2018)
-
Re: Radiant heat panel and Thermestat
I use Herpstat and a Reptile Basics UTH and a Reptile Basics 80 watt RHP in a 2'x3'x12" RBI viv. Works great.
P.S. I prefer Ultratherm UTH but the RBI is fitted for the viv.
-
The Following User Says Thank You to larryd23 For This Useful Post:
-
Registered User
Re: Radiant heat panel and Thermestat
Thank you everyone.
I have been reading some more and see that people are using heat tape and uth in a wood enclosure. I have also seen that a rhp seems to be efficient enough to use alone as a heat source. What are your opinions on this? Also, how much more are the pro heat panels compared to the reptile basics? I sent them an email yesterday, but haven't heard back yet.
-
-
Re: Radiant heat panel and Thermestat
 Originally Posted by ShyPy
Thank you everyone.
I have been reading some more and see that people are using heat tape and uth in a wood enclosure. I have also seen that a rhp seems to be efficient enough to use alone as a heat source. What are your opinions on this? Also, how much more are the pro heat panels compared to the reptile basics? I sent them an email yesterday, but haven't heard back yet.
Another vote for Pro-Products RHP and Herpstat to control them. I have 5 Animal Plastic T10's and a T12 without any UTH and keep temps and humidity well. The only time I need supplemental heat (electric oil heater) is during the winter because I keep my furnace at 55-60 (the room I have them in is "insulated" from the rest of the house.
I do not know the cost comparison, sorry. If you call Bob at Pro Products he's extremely helpful and knowledgeable as he's also a long time reptile keeper.
Ball Python
0.1 Lesser (Lucille) local pet store
Boas
0.1 Caulkers Cay (CC) from TJ Blevins (Second City Constrictors)
1.0 Sunglow het moonglow (Sonny) from Dustin Dirnberger
1.0 BCI - DH Sharp Snow (Bob) from TJ Blevins (Second City Constrictors)
1.0 Brazillian Rainbow Boa (Babylon) from Ike Lightener (Ike's Exotics & Aquatics)
Pythons
0.0.1 Unknown/undocumented rescue (Roger)
1.0 Northern White Lip (Solo)
Cats
1.1 Domestic short hair (Esther and James)
Snake Wishlist
Drymarchon Malanurus (Black Tail Cribno)
SD/D Retic
Woma or Black Headed Python
Other Reptile Wishlist
Poison dart frogs
-
The Following User Says Thank You to BR8080 For This Useful Post:
-
Registered User
Re: Radiant heat panel and Thermestat
So, I just seen a video where the heat panel was placed under a ledge so that there is a hot spot for belly heat on top while also heating the enclosure. I thought that was really smart and getting optimum usage. Any one done that?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|