Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,346

0 members and 1,346 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,934
Threads: 249,128
Posts: 2,572,278
Top Poster: JLC (31,651)
Welcome to our newest member, LavadaCanc
Results 1 to 5 of 5

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    First I would skip over pinks and move straight to hopper mice as they elicit an almost immediate feed response for most hatchling balls.

    I generally do not force feed until a couple months have gone by.

    As far as how often to feed... For the first six months or so I feed as often as they will eat. After that I move to a 5-7 day cycle.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Alicia (07-06-2018),Craiga 01453 (07-06-2018),GalaxyMom (10-06-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1