Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,322

0 members and 2,322 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,408
Threads: 248,769
Posts: 2,570,211
Top Poster: JLC (31,651)
Welcome to our newest member, WheezyS
Results 1 to 7 of 7
  1. #1
    BPnet Veteran Team Slytherin's Avatar
    Join Date
    09-12-2017
    Location
    Los Angeles, CA
    Posts
    608
    Thanks
    556
    Thanked 865 Times in 404 Posts
    Images: 1

    Can rodents carry mites?

    Uggghhh. Picked up a couple live rat fuzzies today for my picky Dumeril’s and when I opened the bag, they were covered in these tiny, mite-looking bugs! Gross! I tried to take a photo, but it’s not very clear.

    Would a snake mite be feeding on a rodent? The little buggers were definitely full of blood. I was super late for work, so bringing them back was not a possibility. I immediately squished as many as I could see and thoroughly looked over the rats. Washed hands and arms, changed shirt and tossed the bag in a dumpster right away...

    Felt bad for the little ratlings, but wtf are these things? They are tiny and red.





    Sent from my iPhone using Tapatalk

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Rodents can carry mites but they are different than snake mites (mites are pretty host specific.)

    That said, what you more likely have there are rat lice:

    https://www.google.com/search?q=rat+...=2560&bih=1486
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    AbsoluteApril (06-08-2018),Bogertophis (06-08-2018),Craiga 01453 (06-08-2018),Team Slytherin (06-08-2018)

  4. #3
    BPnet Lifer Sauzo's Avatar
    Join Date
    11-26-2014
    Location
    Seattle Washington
    Posts
    6,011
    Thanks
    2,064
    Thanked 6,341 Times in 3,220 Posts
    Snakes mites can be on rodents and they can take a blood meal from them if they need to but they arent going to be the choice host. Probably lice or something like posted above.

    Regardless, that is pretty gross and i would definitely find a new feeder supplier.

    And if they let their rodents get that infested, i would be worried about picking up a hitch hiker walking around in the place. The hitch hiker being a snake mite.
    0.1 Rio Bravo Pokigron Suriname BC-Gina
    1.0 Meltzer/Lincoln Peruvian Longtail het anery BCL-Louie

    0.1 Biak Green Tree Python-Pat
    ​1.0 OSHY Biak Green Tree Python-Alex
    0.0.1 Super Reduced Reticulated Gila Monster-Dozer
    0.0.1 Utah Banded Gila Monster-Tank
    0.0.1 Super Black Beaded Lizard-Reggie

  5. The Following 3 Users Say Thank You to Sauzo For This Useful Post:

    Bogertophis (06-08-2018),Craiga 01453 (06-08-2018),Team Slytherin (06-08-2018)

  6. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    Mites are species specific some feed on warm blooded creature some on warm blooded creature so not mite found on rats will not feed on snakes.

    The issue is a snake mite can hitch hike on a feeder and lead to a mite infestation.

    Find another supplier those feeders are not healthy if they carry external parasites they might carry internal ones too which can be transmitted to your snakes.

    I have bred feeders for over a decade and never had a mite infestation in my colony, with proper care and quarantine something like this should not happen.
    Deborah Stewart


  7. The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Bogertophis (06-08-2018),Team Slytherin (06-08-2018)

  8. #5
    BPnet Veteran Team Slytherin's Avatar
    Join Date
    09-12-2017
    Location
    Los Angeles, CA
    Posts
    608
    Thanks
    556
    Thanked 865 Times in 404 Posts
    Images: 1

    Re: Can rodents carry mites?

    Thanks, guys! I’ll keep a close eye out. Now that I think about it, I remember finding a single red, mite-looking crawley on Apophis after I brought him home (from the same shop). I only ever saw one, but treated for mites anyway and the monster never returned. I will definitely steer clear of this place in the future. Especially considering how infested these poor ratlings were! Ugh.


    Sent from my iPhone using Tapatalk

  9. #6
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,526
    Thanks
    28,713
    Thanked 20,191 Times in 12,062 Posts

    Re: Can rodents carry mites?

    Quote Originally Posted by Team Slytherin View Post
    Thanks, guys! I’ll keep a close eye out. Now that I think about it, I remember finding a single red, mite-looking crawley on Apophis after I brought him home (from the same shop). I only ever saw one, but treated for mites anyway and the monster never returned. I will definitely steer clear of this place in the future. Especially considering how infested these poor ratlings were! Ugh. Sent from my iPhone using Tapatalk

    I'd be inclined to tell them why you'll be staying away: it's likely they need the business & if they clean up their act, it's a "win" for their animals. Otherwise,
    consider how many others will buy from them without knowing any better, & ultimately it's the animals that will suffer. Some pet store owners/managers are
    knowledgeable, others not so much: it's possible they haven't noticed the issues, & maybe they're coming from their supplier. They might even appreciate a
    "heads-up"?

    I'm also wondering if they're in violation of any laws...I think I'd also call animal code enforcement for the city, just to see if there's anything they can do?

  10. #7
    BPnet Veteran Team Slytherin's Avatar
    Join Date
    09-12-2017
    Location
    Los Angeles, CA
    Posts
    608
    Thanks
    556
    Thanked 865 Times in 404 Posts
    Images: 1

    Re: Can rodents carry mites?

    Quote Originally Posted by Bogertophis View Post
    I'd be inclined to tell them why you'll be staying away: it's likely they need the business & if they clean up their act, it's a "win" for their animals. Otherwise,
    consider how many others will buy from them without knowing any better, & ultimately it's the animals that will suffer. Some pet store owners/managers are
    knowledgeable, others not so much: it's possible they haven't noticed the issues, & maybe they're coming from their supplier. They might even appreciate a
    "heads-up"?

    I'm also wondering if they're in violation of any laws...I think I'd also call animal code enforcement for the city, just to see if there's anything they can do?
    You are right. Thank you for this advice! I have been in enough times that I should be able to mention it in a tactful and respectful manner. Until now, my Dumeril's hasn't eaten live for the last year, but prior to that I often bought them from this supplier and have never seen this before. I actually bought live rat fuzzies from them a month ago and it was not an issue.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1