Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,265

1 members and 2,264 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,107
Threads: 249,258
Posts: 2,573,010
Top Poster: JLC (31,651)
Welcome to our newest member, cheeseburger
Page 3 of 3 FirstFirst 123
Results 21 to 30 of 30
  1. #21
    Registered User
    Join Date
    02-09-2013
    Posts
    2,385
    Thanks
    200
    Thanked 581 Times in 459 Posts

    Re: Scaleless snakes

    Quote Originally Posted by asplundii View Post

    You are quite mistaken about these animals losing their ability to sense heat. I do not know why people assume that a lack of the physical "pit" means that the snake suddenly loses the ability to sense heat. The nerves for sensing heat are still present in a scale-less ball python and they still reside in the lip area. Losing the scales that define the pit has no impact on the nerves that are present in those areas. In point of fact the pits are the result of an evolutionary process to allow those nerves to be directly exposed and not be covered by scales while still offering a degree of protection to the underlying exposed skin. The snake in that picture is not "half blind" at all, in fact, if you look back at the picture you can make out the indentation of a couple of pits, on just below the nostril and one just forward of there. It can sense heat just fine.
    yes they can still sense heat, just like i can with the back of my hand. But they can no longer sense which direction the heat is coming from. If you have a pit, and a source of warmth in front of you, some areas in the pit will get infrared radiation and other areas of the pit are in the shadow.

    .......... <--- two heat sources (please ignore the points ....... couldnt get it done without them, formatting issues)

    ........---- <--- flat surface

    in this case, both heat sources cannot be distinguished from one another. both illuminate all of the heat-sensitive skin.

    ........... <--- two heat sources

    .........\/\/ <--- surface with pits

    in this case, the two sources of radiation can be distinguished. when the left heat source is radiating, the green segments will be activated and the red ones will be in shadow. Ball pythons, with their row of 10 heat pits, can do that so well that blind snakes can find and strike a rhodent and hit it. Flatten the surface, and almost all the data is lost. its like having an eye without a lens, that only senses how bright it is in front of the head, without producing an image.

    so i do think the heat pit issue is a real issue.

  2. #22
    BPnet Senior Member xFenrir's Avatar
    Join Date
    12-20-2010
    Location
    Maryland, USA
    Posts
    1,157
    Thanks
    51
    Thanked 427 Times in 280 Posts
    Images: 9
    Not trying to start anything, but I think the whole argument of "would it survive in the wild?" is completely irrelevant when you're talking about animals that will never know what the "wild" is. The wild has mainly "normals" because that's what survives best out there. But in captivity, there's no advantage or disadvantage to color or size or any other physical attribute. Also, there are very few morphs that actually carry a genetic flaw, like the Spider or Pearl.

    I feel it's an apples to oranges comparison. Why debate it, unless you're somehow planning to release morphs BACK to the wild?
    --------
    1.0 Husband
    0.1 Colombian BCI (Satin)

    0.1 Spider BP (Loki), R.I.P... We will never forget you...

  3. The Following 2 Users Say Thank You to xFenrir For This Useful Post:

    C.Marie (05-25-2018),Crotalids (02-28-2013)

  4. #23
    BPnet Senior Member meowmeowkazoo's Avatar
    Join Date
    09-11-2011
    Location
    Ogden, Utah
    Posts
    1,755
    Thanks
    1,549
    Thanked 763 Times in 468 Posts
    Scaleless snakes are gross looking.
    [Python regius]
    1.0 Black Butter Pinstripe (Amazeballs), 1.0 Pastel Butter Leopard (Thunderbeeper)
    0.1 Spider (Charlotte), 0.1 Leopard (Spot), 0.1 Pastel (Buttercup), Fire Sugar (Abaddon), Crystal (Opalescence)

    [Python brongersmai]
    1.1 T+ Albino (Kushiel & Carmilla)

    [Boa imperator]
    1.0 Hypo 100% Het Leopard/66% Het Albino (Darcy)
    0.1 66% Het Leopard/Albino (Gabby)


    [Colubrids]
    0.1 Cave-dwelling Rat Snakes (Betty Spaghetti)

  5. #24
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Scaleless snakes

    Quote Originally Posted by Kurtilein View Post
    yes they can still sense heat, just like i can with the back of my hand. But they can no longer sense which direction the heat is coming from. If you have a pit, and a source of warmth in front of you, some areas in the pit will get infrared radiation and other areas of the pit are in the shadow.

    in this case, both heat sources cannot be distinguished from one another. both illuminate all of the heat-sensitive skin.

    in this case, the two sources of radiation can be distinguished. when the left heat source is radiating, the green segments will be activated and the red ones will be in shadow. Ball pythons, with their row of 10 heat pits, can do that so well that blind snakes can find and strike a rhodent and hit it. Flatten the surface, and almost all the data is lost. its like having an eye without a lens, that only senses how bright it is in front of the head, without producing an image.

    so i do think the heat pit issue is a real issue.

    And again I contend that the heat pit issue it is not one.

    Your hand analogy is comparing apples to oranges. First off, you can tell direction of heat from the back of your hand (or at least I can at any rate) but more importantly, the nerves on the back of your hand are not evolved for the purpose of heat detection unlike the nerves that populate the pits. Secondly, the heat-sensing nerves are so sensitive that they can detect fractions of a degree differences so the, for lack of a better term, "decay" of heat over distance between any, say, three pits would create a heat "gradient" that would allow for accurate pinpointing.

    Further, the upper lip area of a ball python is not flat like your example would contend, but is instead curved which adds another dimension by which to create a "gradient" for detection and would most certainly provide a right/left orientation.

    Lastly, there are a second set of pits on each side of the mouth that line the back region of the lower jaw area. These increase the amount of information received by the animal thereby offering greater "resolution" of the direction of the source.


    Or, in a rough picture:

    Ball python face

    ......____
    ...../......\
    ..../........\
    .../...........\
    ../.............\
    ./..............\
    /................\



    And now if we insert your heat sources:

    ..........



    ......____
    ...../......\
    ..../........\
    .../...........\
    ../.............\
    ./..............\
    /................\


    If you project the path of the "heat" from each source then the simple bilateral nature of the head give the snake the ability to orient left/right without the need for pits. And having three separate regions of heat-sensing nerves, each made up of multiple sub-components, allows for a "parallax" that provides further information about the position and distance of the heat source.

    Basically the face of the ball python is a heat interferometer, even without the physical structure of the pits
    Last edited by asplundii; 03-04-2013 at 11:12 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    C.Marie (05-25-2018)

  7. #25
    BPnet Lifer zina10's Avatar
    Join Date
    08-09-2010
    Location
    southeast
    Posts
    4,573
    Thanks
    5,693
    Thanked 6,186 Times in 2,610 Posts
    interesting..

    but I have to say, I'm sure the pits are there for a reason, perhaps they protect that area.

    Still not a fan..
    Last edited by zina10; 05-25-2018 at 11:24 AM.
    Zina

    0.1 Super Emperor Pinstripe Ball Python "Sunny"
    0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna"
    0.1 Pastel Desert Ghost Ball Python "Arjanam"
    0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora"
    0.1 Pastel Enchi Desert Ghost Ball Python "Venus"
    1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius"
    1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"

    "It is only with the heart that one can see rightly; what is essential is invisible to the eye."
    - Antoine de Saint-ExupÈry

  8. #26
    BPnet Senior Member Skyrivers's Avatar
    Join Date
    01-15-2018
    Posts
    2,789
    Thanks
    183
    Thanked 2,135 Times in 1,197 Posts

    Re: Scaleless snakes

    Quote Originally Posted by Skiploder View Post
    Why settle for scaleless?

    I'm sure if the community tried hard enough, a skinless ball python could be bred.
    Why stop at skinless? Why not zombie?

    hehehehehehehehehe.

    Sorry could not resist.

  9. #27
    BPnet Veteran JRLongton's Avatar
    Join Date
    02-27-2017
    Location
    Attleboro, Massachusetts
    Posts
    378
    Thanks
    527
    Thanked 408 Times in 228 Posts
    Images: 12
    Please read my post in the respectful tone in which I intended it to be read.

    I'm no biologist, but I'm sure those pits are there for a reason.

    I don't need any complicated explanation to understand that a covered heat sensing pit is less sensitive than an open one.

    How much less? Is it marginal, like wearing a pair of clear glass glasses, or is it more dramatic, like wearing a pair of dirty extra dark sunglasses?

    We simply can't know because the BP can't tell us. But maybe we want to be a bit more hesitant before we so drastically alter the creatures physiology.
    \m/

  10. The Following User Says Thank You to JRLongton For This Useful Post:

    Bogertophis (05-25-2018)

  11. #28
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1
    5 years thread peeps
    Deborah Stewart


  12. The Following 3 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    asplundii (05-29-2018),C.Marie (05-25-2018),dr del (05-25-2018)

  13. #29
    BPnet Veteran JRLongton's Avatar
    Join Date
    02-27-2017
    Location
    Attleboro, Massachusetts
    Posts
    378
    Thanks
    527
    Thanked 408 Times in 228 Posts
    Images: 12

    Re: Scaleless snakes

    LOL!!

    I dind't notice. There was a similar thread going on recently and I thought this was a continuation.
    \m/

  14. #30
    BPnet Lifer zina10's Avatar
    Join Date
    08-09-2010
    Location
    southeast
    Posts
    4,573
    Thanks
    5,693
    Thanked 6,186 Times in 2,610 Posts

    Re: Scaleless snakes

    Quote Originally Posted by Deborah View Post
    5 years thread peeps
    True, but this was linked to from a current thread
    Zina

    0.1 Super Emperor Pinstripe Ball Python "Sunny"
    0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna"
    0.1 Pastel Desert Ghost Ball Python "Arjanam"
    0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora"
    0.1 Pastel Enchi Desert Ghost Ball Python "Venus"
    1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius"
    1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"

    "It is only with the heart that one can see rightly; what is essential is invisible to the eye."
    - Antoine de Saint-ExupÈry

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1