» Site Navigation
0 members and 1,047 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,090
Threads: 249,230
Posts: 2,572,849
Top Poster: JLC (31,651)
|
-
Re: Didn't expect to see this on morph market...
 Originally Posted by Crowfingers
just out of curiosity, do the scales snakes have any issues? Like getting cut/scraped easier, retaining water, shedding, shorter lifespan? It just seems so unnatural to see a reptile without scales.
Like the hairless cats...unnatural and they are prone to some genetic issues
**No judgment on any breeders, just wondering
I heard about the shedding thing too, but I really think that was only a rumor as it hasn't really become major news to anyone yet. Probably do get cut/scraped a bit easier, so no live feeders, and im guessing that they are MUCH more sensitive to sunlight. I cant imagine the sunburn.
*****
The more silent you become, the more you are able to hear...
1.0 Super Cinny Banana Het Ghost BP - "Churro"
1.0 Mack Snow Leopard Gecko
0.1 Normal Leopard Gecko
-
-
I don't know....
That snake is absolutely gorgeous. No question, and I'm sure its body feels phenomenal.
However, playing with coloring and patterns is one thing, changing an animals physiology for aesthetic purposes is going a little too far, in my opinion.
I look at this creature and think about the pug, which are essentially deformed dogs breed to suffer for a lifetime in order to suit their breeders' warped view of canine beauty.
This may not be to that level, but it is starting on that path. It's already a creature that can't feed on live prey (not that I feed live). BPs are almost completely defenseless creatures already, now they are being breed to be utterly vulnerable?
Moreover, these projects are so new that nobody really knows about the long term complications of scalelessness, if any.
Final point. I know that I have voiced an unpopular and controversial view. I offer it only as my honest personal opinion and NOT as a challenge.
I welcome and respect disagreement, but I'm not interested in making this an issue. Therefore I will not be posting any follow ups.
Thank you and best regards to all.
-
The Following 2 Users Say Thank You to JRLongton For This Useful Post:
Crowfingers (05-24-2018),purpleroan (06-02-2018)
-
Its pigs snout freaks me out !!!!!!!!!!!
Look at it. Just like a pig. What is that ???
Sorry, but not a fan. I think they look sort of cool because as hatchlings it makes them look clean. Feel soft too, I'm sure. But Ball Pythons are very heavy bodied snakes (unlike corns and such) I've seen older scale less BP's and that just wasn't a good look on them. Wart looking things, strange wrinkles with fat oozing in between.
And no heat pits? Like its been said, its one thing to change coloration, but to breed for morphs that are missing such vital parts of their physiology just goes to far in MY opinion.
But, to each their own. Others might find that attractive, and that is their prerogative
Zina
0.1 Super Emperor Pinstripe Ball Python "Sunny" 0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna" 0.1 Pastel Desert Ghost Ball Python "Arjanam" 0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora" 0.1 Pastel Enchi Desert Ghost Ball Python "Venus" 1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius" 1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"
"It is only with the heart that one can see rightly; what is essential is invisible to the eye." - Antoine de Saint-ExupÈry
-
The Following User Says Thank You to zina10 For This Useful Post:
-
Re: Didn't expect to see this on morph market...

Corns and colubrids that stay slender might not have that issue, but a heavy bodied snake is just going to cause that skin to stretch out in not so good ways without the protection of the scales. If you zoom in, you can already see the wrinkles that look like cracks in the dark spots of that snake. Once it gets older, that look is not going to be great. The scales are a vital part of their physiology, and so are the heat pits.
To me that is juts like breeding for a snake with no eyes. Or tongue. Or other missing and defunct parts. Just one step to far, IMHO!
Last edited by zina10; 05-24-2018 at 02:57 PM.
Zina
0.1 Super Emperor Pinstripe Ball Python "Sunny" 0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna" 0.1 Pastel Desert Ghost Ball Python "Arjanam" 0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora" 0.1 Pastel Enchi Desert Ghost Ball Python "Venus" 1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius" 1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"
"It is only with the heart that one can see rightly; what is essential is invisible to the eye." - Antoine de Saint-ExupÈry
-
The Following 2 Users Say Thank You to zina10 For This Useful Post:
Alter-Echo (05-25-2018),Crowfingers (05-24-2018)
-
Re: Didn't expect to see this on morph market...
 Originally Posted by zina10
And no heat pits?
Not saying this as a defense of Scaleless but people really need to stop thinking these animals cannot sense heat just because the physical "pit" is not present. All the nerves that wire them for heat detection are still in place and, to an extent, there is still the "pit" puckering along both the upper and lower jaw line that. Years ago I made a post explaining all of this in detail but the long and the short of it is that these animals can sense heat just fine.
Here is my old post if anyone is interested: https://ball-pythons.net/forums/show...=1#post2030947
Last edited by asplundii; 05-25-2018 at 08:14 AM.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Personally, I'm really waiting to see the long term complications of scaleless before I really render any opinions on it. As babies they are absolutely stunning, do doubt about it, but i'm curious of that they'll be like when fully grown. As Zina said, they do get quite big, compared to something like a texas rat, so I really don't know what that would end up looking like...
I think they're really only being bred right now because they're reletivly new and also because not much research has been done on them. They're really a "high-tier breeders only" snake right now for the price ($30000? Damb.), so I don't really see them going commercial any time soon. I feel this is going to sort of come up like the Spider controversy (nero issues and such) though in a much more severe way, if that makes sense?
*****
The more silent you become, the more you are able to hear...
1.0 Super Cinny Banana Het Ghost BP - "Churro"
1.0 Mack Snow Leopard Gecko
0.1 Normal Leopard Gecko
-
-
Re: Didn't expect to see this on morph market...
 Originally Posted by asplundii
Not saying this as a defense of Scaleless but people really need to stop thinking these animals cannot sense heat just because the physical "pit" is not present. All the nerves that wire them for heat detection are still in place and, to an extent, there is still the "pit" puckering along both the upper and lower jaw line that. Years ago I made a post explaining all of this in detail but the long and the short of it is that these animals can sense heat just fine.
Here is my old post if anyone is interested: https://ball-pythons.net/forums/show...=1#post2030947
Where exactly did you find the research?
Given, I have only done a quick research, but everything I've found explains that no-one is 100% sure how it works, whether it is the membranes themselves or the nerves behind them that do the actual detection (not just sending the information on..)
Here is a part of one study:
"While the role of the pit organ as an infrared sensor is well established, fundamental questions remain regarding its mechanism of stimulus detection. For example, does the membrane, itself, contain the infrared sensor, or is the sensor expressed by the closely apposed nerve fibers? What is the molecular identity of the infrared sensor, and can its intrinsic biophysical characteristics account for the physiological properties of the pit organ?"
Also, all of them speak of "the membrane". Which by definition is a thin and fragile thing. One can actually see it in the pits. Many articles explain the membranes "hangs" in the back of the pit. It would make sense that such a membrane needs protection and that may very well be why it resides in a pit. Membranes are easily damaged or punctured.
So, I feel that there is a good reason those pits exist. Just like there is a good reason scales cover the skin of an animal that slithers on and around "stuff". Maybe not so much in captivity, but certainly in the wild. Their body drags across and around stuff, they squeeze in between things. Things and stuff that can be rough, sharp, etc. Being that their skin is usually covered in scales, that skin is most likely far more fragile then lets say ours, that is not protected by a thick coat of hair or scales.
Whether they can detect heat or not, whether being in captivity mostly protects that fragile skin or not, to me, that is a step to far.
But like I've said before and I maintain that, if some people find that beautiful or worthy, that is their prerogative. If some want to breed for that, again, that is their business.
Opinions vary, and beauty is in the eye of the beholder..
Zina
0.1 Super Emperor Pinstripe Ball Python "Sunny" 0.1 Pastel Orange Dream Desert Ghost Ball Python "Luna" 0.1 Pastel Desert Ghost Ball Python "Arjanam" 0.1 Lemonblast Enchi Desert Ghost Ball Python "Aurora" 0.1 Pastel Enchi Desert Ghost Ball Python "Venus" 1.0 Pastel Butter Enchi Desert Ghost Ball Python "Sirius" 1.0 Crested Gecko ( Rhacodactylus ciliatus) "Smeagol"
"It is only with the heart that one can see rightly; what is essential is invisible to the eye." - Antoine de Saint-ExupÈry
-
-
Registered User
Re: Didn't expect to see this on morph market...
Am I the only one who loves the scales? Lol
Has anyone seen a female scaleless on eggs?
There's a video on YouTube where Kevin at NERD mentions that he had a little issues with shedding but nothing he doesn't think he can eventually figure out and work around.
The scaleless python is novel. People like novel and novel ALWAYS sells. Horses for courses... this horse likes good old fashioned grass.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|