Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 834

0 members and 834 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 9 of 9

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What substrate do you use for your O. Porphyraceus Coxi?

    Quote Originally Posted by Deborah View Post
    Easiest substrate for burrowing animals are coco coir type substrate (regardless of the brand)
    I have a few species that are prone to burrowing and I will concur with the coir-type substrate with a small caveat; if you can find some, then for every 5 parts coir I suggest adding one part high quality sphagnum (NZ or Orchid I find are best) and one to two parts oak leaf litter (you could use magnolia as well but you will need to break them up as they are much larger than oak leaves). I have found that using this mix helps keep the coir from compacting, helps the coir maintain a bit more stable hydration level (e.g., not drying out to a brick and then turning into a soggy mess), and creates an easier burrowing substrate for the animals because there are little air gaps and roughage for traction/leverage. I also think it looks a bit nicer/more natural that just straight coir.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Prognathodon (05-24-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1