Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 587

1 members and 586 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 18

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Didn't expect to see this on morph market...

    Quote Originally Posted by dr del View Post
    I think the het is missing some head scales but ir otherwise normal?
    Yes, Scaleless-head is the het form and is characterized by missing head scales and also a general difference in the appearance of the scalation on the body. They also have reduced labial heat-pits.


    Quote Originally Posted by dr del View Post
    There are a few similar ( though not identical) morphs including the true scaleless and the microscale? Some body please correct me if I'm way off base here?
    There is no one "true Scaleless". Both the superform of Scaleless-head and the superform of Microscale are scaleless-type animals. So far, all of the Scaleless animals on MorphMarket have been SuperScaleless-head
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Albert Clark (05-24-2018),dr del (05-25-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1