Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,330

0 members and 2,330 guests
No Members online
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.

» Today's Birthdays

None

» Stats

Members: 75,895
Threads: 249,089
Posts: 2,572,053
Top Poster: JLC (31,651)
Welcome to our newest member, TwoToedSloth
Results 1 to 8 of 8
  1. #1
    Registered User CottonMouth's Avatar
    Join Date
    05-11-2018
    Location
    Wakanda
    Posts
    34
    Thanks
    42
    Thanked 27 Times in 12 Posts

    Carpet Python Non-Rodent Diet

    Would love to get your opinions on my Coastal/Jungle Carpet Python's diet.
    It's a long story but she refuses to eat rats, don't want to bore you guys.

    But at the moment she gets a 200g to 250g Quail every 14 days or so, I'd say about the equivalent of a Medium Sized Rat in terms of weight, maybe a large?
    She is a Female Adult 3.5 Years Old. She's been on this feeding for about a year, and to me, she looks very healthy, good length, good weight.

    She'll eat anything other than rats lol, Hamsters, Rabbit, Mice... The reason I went with the Quail diet was that I heard many good reviews on a bird diet for your snake and I didn't think the other options were appropriate in terms of enough nutrition, other than rabbit but a bit too pricey to have all the time.

    As Carpet Owners do you feed your adults a medium-sized rat or large? Would love to get your opinions if you think I should be fine with the way I'm going or maybe you completely disagree and I should go back to trying rats or maybe I should be using a different type of bird instead?

    Or perhaps there are owners out there in a similar situation and their Snake(s) only eat a particular Non-Rodent diet, would love to hear your experiences.

    It's nice to have a place to go and discuss snakes lol, can't have these conversations with friends and family.
    ~We Don't Have To Agree On Anything To Be Kind To One Another~

  2. #2
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts
    I had a mangrove snake that would only eat birds, and the angry monster lived 12 years with no apparent health issues. He came to me fully grown, so I have no idea how old he may have been, being wild caught and all. Only thing I found was that snakes seem to digest birds faster, so I needed to feed more often than if I were feeding rodent prey. Poops were pretty loose as well, but over all they seemed to be nutritionally sound.

  3. #3
    BPnet Veteran rock's Avatar
    Join Date
    12-06-2016
    Location
    Miami, FL
    Posts
    513
    Thanks
    735
    Thanked 388 Times in 250 Posts
    Images: 42

    Re: Carpet Python Non-Rodent Diet

    I’ll begin where you ended. I can’t have these conversations with personal friends or family either as none of them have snakes or would want to. Oh well...

    As for my Morelia Bredli, he is 2.5 years old, roughly 4-5 feet long. I’m not sure of his exact weight at the moment and I’ve only feed him rats to this point. Sometimes large but most often medium sized rats. From 1.5 years old until 2 it was a medium rat every 7 days but for the past 6 months I’ve varied the length of time between feedings and it’s always more than 7 days. It seems to be working. He only refused once when he was in shed. I will probably mix in large rats more often now as he has put on size.

    I’ve thought of varying his diet as well but I’ve been afraid he might choose to not eat rats. Btw, I still feed live so I don’t know if that helps or not.
    0.1 Super Pastel BP "Melly"
    1.0 Banana/Coral Glow BP "Titan"
    1.0 Morelia Bredli "Alpha Omega"
    0.1 Cavachon "Lola"
    0.1 Tabby Cat “Gato”
    0.2 Chickens
    1.0 Thoroughbred “Beau”
    1.0 Siberian Hamster "Bean"
    0.1 Wife
    1.2 Kids

    Full House Living the suburban farm life in Miami.

  4. The Following User Says Thank You to rock For This Useful Post:

    RickyNY (05-22-2018)

  5. #4
    BPnet Royalty EL-Ziggy's Avatar
    Join Date
    11-05-2014
    Location
    GA
    Posts
    4,224
    Thanks
    5,090
    Thanked 5,533 Times in 2,710 Posts

    Re: Carpet Python Non-Rodent Diet

    I believe most animals will eat anything if they're hungry enough but the most important thing is that your snake is healthy. I feed my adult carpets mostly medium to jumbo rats but they'll get chicks and mice as snacks sometimes. I'd like to try them with rabbits soon too. I'm a big fan of a varied diet for all my snakes. I feed my critters every 14 days on average.
    Last edited by EL-Ziggy; 05-22-2018 at 12:10 AM.
    3.0 Carpet Pythons, 1.1 Bullsnakes
    1.0 Olive Python 1.0 Scrub Python,
    1.0 BI, 0.1 BCO

  6. The Following 2 Users Say Thank You to EL-Ziggy For This Useful Post:

    Craiga 01453 (05-22-2018),RickyNY (05-22-2018)

  7. #5
    Registered User CottonMouth's Avatar
    Join Date
    05-11-2018
    Location
    Wakanda
    Posts
    34
    Thanks
    42
    Thanked 27 Times in 12 Posts

    Re: Carpet Python Non-Rodent Diet

    Quote Originally Posted by Alter-Echo View Post
    I had a mangrove snake that would only eat birds, and the angry monster lived 12 years with no apparent health issues. He came to me fully grown, so I have no idea how old he may have been, being wild caught and all. Only thing I found was that snakes seem to digest birds faster, so I needed to feed more often than if I were feeding rodent prey. Poops were pretty loose as well, but over all they seemed to be nutritionally sound.
    Loool haven't we all had at least one Angry Monster we just didn't know what to do with, had a Blood Python I kept saying I was going to drop off at my Mother-in-Laws backyard. I always told myself that it seemed she would digest the Bird a lot easier, even though it would leave a big bulge in her, she just seemed more comfortable the next 48 hours. I personally never found a difference in her poop.

    It's good to know EL-Ziggy and Rock you guys are doing Large Rats and even Jumbo, something to consider. If I ever did 2 Quail at a time I think I would push it to 21 days. I feel like sometimes we as owners feed our snakes a bit more, and without the freedom to roam as much as they can in the wild to burn it off. I remember talking to 2 Veterans at a reptile show and they said back in their days they were feeding their adult snakes Once a month, that "Us new guys spoil our snakes nowadays"
    Definitely got me thinking.
    ~We Don't Have To Agree On Anything To Be Kind To One Another~

  8. #6
    BPnet Lifer Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,781
    Thanks
    29,327
    Thanked 20,552 Times in 12,280 Posts

    Re: Carpet Python Non-Rodent Diet

    Quote Originally Posted by EL-Ziggy View Post
    ... I'm a big fan of a varied diet for all my snakes. I feed my critters every 14 days on average.
    I think that's healthier, more natural, when they'll accept some variation. Not all snakes will, but maybe that's because they don't get as hungry as they
    do in the wild. Speaking for myself, I'd never touch canned Dinty Moore Beef Stew at home, but it sure is good when I'm camping out... Same thing?

  9. #7
    BPnet Veteran Prognathodon's Avatar
    Join Date
    09-21-2015
    Location
    NE Illinois
    Posts
    1,194
    Thanks
    1,344
    Thanked 923 Times in 550 Posts
    Images: 2

    Re: Carpet Python Non-Rodent Diet

    My carpets get fed every two weeks (once per week when they were youngsters). My big Bredli Yingarna gets mostly medium rats, occasionally large, with a rabbit kit/juvenile about once a month. Same schedule for Yurlunggur/Bruce, my JCP, except he doesn’t get the large rats. Moresby, my younger IJCP gets weaned rats or pups.

    Bruce and Ying have also gotten chicks occasionally. I offered Moresby a rabbit kit last week and he wanted nothing to do with it. I haven’t tried him on any type of bird yet.


    Sent from my iPad using Tapatalk Pro
    0.4 BPs, 0.1 Antaresia, 2.1 Morelia, 0.0.1 Liasis, 1.0 Aspidites, 0.1 Blood, 1.1 Kings, 2.0 Milks, 1.2 Corns, 2.0 Ratsnakes, 0.1 Hognose, 1.0 RTB, 2.1 KSBs, 1.0 Tortoise, 1.0 Skink, 3.0 dogs, 2.1 Human serfs

  10. The Following User Says Thank You to Prognathodon For This Useful Post:

    rock (05-22-2018)

  11. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    If your animal is eating and healthy then I do not see the need to try and force it to eat something it does not want to eat. Remember, rats are not the normal diet for most all the snakes we keep, this is especially true when it comes to carpet pythons, they are just a convenient feeder for us to feed them in captivity. In the past they were pretty much the only option but now we have more choices and I say make full use of that freedom; Qu'ils mangent de la caille
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1