» Site Navigation
0 members and 995 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,144
Posts: 2,572,366
Top Poster: JLC (31,651)
|
-
Didn't expect to see this on morph market...
Was browsing the "recent" section (during class, of course!) and came across the first scaleless BP i've seen on MM:
https://www.morphmarket.com/us/c/rep...pythons/105260
And *only* $30,000!
I do have to admit, they are quite the pretty color, though.
*****
The more silent you become, the more you are able to hear...
1.0 Super Cinny Banana Het Ghost BP - "Churro"
1.0 Mack Snow Leopard Gecko
0.1 Normal Leopard Gecko
-
-
Also, its classified as a "Super Scaleless Head", which I find interesting. Its a co-dominant trait?
*****
The more silent you become, the more you are able to hear...
1.0 Super Cinny Banana Het Ghost BP - "Churro"
1.0 Mack Snow Leopard Gecko
0.1 Normal Leopard Gecko
-
-
There have been 8 or 10 on there in recent months... Mojave Scaleless, Phantom Scaleless, Lemonblast Scaleless... Think I remember seeing a Fire Scaleless...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Didn't expect to see this on morph market...
 Originally Posted by Slicercrush
Also, its classified as a "Super Scaleless Head", which I find interesting. Its a co-dominant trait?
I think the het is missing some head scales but ir otherwise normal? There are a few similar ( though not identical) morphs including the true scaleless and the microscale? Some body please correct me if I'm way off base here?
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
-
Microscale has smaller than normal scales, in some cases they are missing some scales along the sides. Scaleless head is the het form of a full scaleless, and is missing a patch of scales on top of the head.
-
-
Re: Didn't expect to see this on morph market...
OMG!!!! That is the same price of a brand new car...at least mine. $450 was the most I ever paid for a bp.
-
-
Gorgeous snake. EBN makes some really nice stuff.
My understanding is that the scaleless head gene is co-dom and a fully scaleless snake is the super form. A lot of people call the scaleless heads "hets", but they're no more recessive than "het" red axanthics.
~ Ball Pythons - Rosy Boas - - Western Hognose Snakes - Mexican Black Kingsnakes - Corn Snakes ~
Check me out on iHerp, Instagram, & visit my store!

-
-
Re: Didn't expect to see this on morph market...
just out of curiosity, do the scales snakes have any issues? Like getting cut/scraped easier, retaining water, shedding, shorter lifespan? It just seems so unnatural to see a reptile without scales.
Like the hairless cats...unnatural and they are prone to some genetic issues
**No judgment on any breeders, just wondering
 No cage is too large - nature is the best template - a snoot can't be booped too much
-
-
Well.... there are rumors about serious shedding issues, but either there is a serious cover up, or the rumors were started by people looking to slander the original guy who started the project.... I'm guessing the latter.
As far as getting injured more easily, that's kind of a given considering you just removed the snake' s armored plating. I wouldn't even think of feeding one of these things live prey....
-
The Following User Says Thank You to Alter-Echo For This Useful Post:
-
Re: Didn't expect to see this on morph market...
 Originally Posted by dr del
I think the het is missing some head scales but ir otherwise normal?
Yes, Scaleless-head is the het form and is characterized by missing head scales and also a general difference in the appearance of the scalation on the body. They also have reduced labial heat-pits.
 Originally Posted by dr del
There are a few similar ( though not identical) morphs including the true scaleless and the microscale? Some body please correct me if I'm way off base here?
There is no one "true Scaleless". Both the superform of Scaleless-head and the superform of Microscale are scaleless-type animals. So far, all of the Scaleless animals on MorphMarket have been SuperScaleless-head
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Albert Clark (05-24-2018),dr del (05-25-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|